EMAIL THIS PAGE TO A FRIEND

NPL

N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)

Synonyms: C112 C1orf13 NAL NPL1
UniProtKB ID: Q9BXD5, B2R839, Q4G0Q8, Q4G0Z2, Q64L88, Q6PEL0
Gene ID:
Human(80896) Summary: This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(74091) N-acetylneuraminate pyruvate lyase
Rat(304860) N-acetylneuraminate pyruvate lyase
Zebrafish(100148292) N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
chicken(429074) N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
cow(507597) N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
domestic cat(101091498) N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
dog(490313) N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
naked mole-rat(101721787) N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
domestic guinea pig(100734839) N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
sheep(101104513) N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030769 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030769 Rosetta Predictions human pricing
NM_001013984 Rosetta Predictions rat pricing
NM_028749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227699 predicted 997
2 SASI_Hs01_00227700 predicted 400
3 SASI_Hs01_00227701 predicted 565
4 SASI_Hs01_00227702 predicted 570
5 SASI_Hs01_00227703 predicted 801
6 SASI_Hs01_00227705 predicted 918
7 SASI_Hs02_00358312 predicted 962
8 SASI_Hs01_00227706 predicted 1022
9 SASI_Hs01_00227707 predicted 645
10 SASI_Hs01_00227708 predicted 755
11 SASI_Hs01_00227704 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045260 predicted 308
2 SASI_Rn01_00045261 predicted 1035
3 SASI_Rn01_00045262 predicted 931
4 SASI_Rn01_00045263 predicted 602
5 SASI_Rn01_00045264 predicted 422
6 SASI_Rn01_00045266 predicted 1017
7 SASI_Rn01_00045267 predicted 798
8 SASI_Rn01_00045268 predicted 568
9 SASI_Rn02_00201335 predicted 370
10 SASI_Rn02_00201336 predicted 289
11 SASI_Rn01_00045265 predicted 821
12 SASI_Rn01_00045269 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125801 predicted 327
2 SASI_Mm01_00125802 predicted 716
3 SASI_Mm01_00125803 predicted 823
4 SASI_Mm02_00334330 predicted 613
5 SASI_Mm01_00125804 predicted 934
6 SASI_Mm01_00125805 predicted 1048
7 SASI_Mm01_00125807 predicted 1028
8 SASI_Mm01_00125808 predicted 285
9 SASI_Mm01_00125809 predicted 823
10 SASI_Mm01_00125810 predicted 804
11 SASI_Mm01_00125806 predicted 657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028749
NPL MISSION shRNA Bacterial Glycerol Stock
N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028749.1-1253s1c1
Sequence:CCGGCTCTACTTATACAGATGCAATCTCGAGATTGCATCTGTATAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-818s1c1
Sequence:CCGGCCAGTTTCGTATCCAGAGATTCTCGAGAATCTCTGGATACGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-153s1c1
Sequence:CCGGGAAATCAACTTTCCTGTCATTCTCGAGAATGACAGGAAAGTTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-408s1c1
Sequence:CCGGGCTGTCATTGCGCCTTTCTTTCTCGAGAAAGAAAGGCGCAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-976s1c1
Sequence:CCGGCCAAGCTAAAGAGCCTGGATTCTCGAGAATCCAGGCTCTTTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028749.1-646s21c1
Sequence:CCGGAGAATCACCAGCGACAGTTTGCTCGAGCAAACTGTCGCTGGTGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028749.1-1029s21c1
Sequence:CCGGCCTTTAGCTAGTGCCTGATAACTCGAGTTATCAGGCACTAGCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028749.1-1119s21c1
Sequence:CCGGGAATTTGAACCCATCTTTATTCTCGAGAATAAAGATGGGTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028749.1-330s21c1
Sequence:CCGGATTCACGTGGGAGCACTAAACCTCGAGGTTTAGTGCTCCCACGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028749
NPL MISSION shRNA shRNA Plasmid DNA
N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028749.1-1253s1c1
Sequence:CCGGCTCTACTTATACAGATGCAATCTCGAGATTGCATCTGTATAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-818s1c1
Sequence:CCGGCCAGTTTCGTATCCAGAGATTCTCGAGAATCTCTGGATACGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-153s1c1
Sequence:CCGGGAAATCAACTTTCCTGTCATTCTCGAGAATGACAGGAAAGTTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-408s1c1
Sequence:CCGGGCTGTCATTGCGCCTTTCTTTCTCGAGAAAGAAAGGCGCAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-976s1c1
Sequence:CCGGCCAAGCTAAAGAGCCTGGATTCTCGAGAATCCAGGCTCTTTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028749.1-646s21c1
Sequence:CCGGAGAATCACCAGCGACAGTTTGCTCGAGCAAACTGTCGCTGGTGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028749.1-1029s21c1
Sequence:CCGGCCTTTAGCTAGTGCCTGATAACTCGAGTTATCAGGCACTAGCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028749.1-1119s21c1
Sequence:CCGGGAATTTGAACCCATCTTTATTCTCGAGAATAAAGATGGGTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028749.1-330s21c1
Sequence:CCGGATTCACGTGGGAGCACTAAACCTCGAGGTTTAGTGCTCCCACGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028749
NPL MISSION shRNA Lentiviral Transduction Particles
N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028749.1-1253s1c1
Sequence:CCGGCTCTACTTATACAGATGCAATCTCGAGATTGCATCTGTATAAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-818s1c1
Sequence:CCGGCCAGTTTCGTATCCAGAGATTCTCGAGAATCTCTGGATACGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-153s1c1
Sequence:CCGGGAAATCAACTTTCCTGTCATTCTCGAGAATGACAGGAAAGTTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-408s1c1
Sequence:CCGGGCTGTCATTGCGCCTTTCTTTCTCGAGAAAGAAAGGCGCAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028749.1-976s1c1
Sequence:CCGGCCAAGCTAAAGAGCCTGGATTCTCGAGAATCCAGGCTCTTTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028749.1-646s21c1
Sequence:CCGGAGAATCACCAGCGACAGTTTGCTCGAGCAAACTGTCGCTGGTGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028749.1-1029s21c1
Sequence:CCGGCCTTTAGCTAGTGCCTGATAACTCGAGTTATCAGGCACTAGCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028749.1-1119s21c1
Sequence:CCGGGAATTTGAACCCATCTTTATTCTCGAGAATAAAGATGGGTTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028749.1-330s21c1
Sequence:CCGGATTCACGTGGGAGCACTAAACCTCGAGGTTTAGTGCTCCCACGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030769
VALIDATED
NPL MISSION shRNA Bacterial Glycerol Stock
N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-758s1c1
Sequence:CCGGCTTCTCTTTAGCCCTGAACTACTCGAGTAGTTCAGGGCTAAAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-333s1c1
Sequence:CCGGGCCCAACATGCAGCAGAAATACTCGAGTATTTCTGCTGCATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-557s1c1
Sequence:CCGGGCTGAAATTCAGTGATACAGACTCGAGTCTGTATCACTGAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-915s1c1
Sequence:CCGGGAGTTTACTGATAGTGCTGAACTCGAGTTCAGCACTATCAGTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-96s1c1
Sequence:CCGGCCAATGACTGAGAATGGAGAACTCGAGTTCTCCATTCTCAGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-367s21c1
Sequence:CCGGTCGCTGTCATTGCACCGTTCTCTCGAGAGAACGGTGCAATGACAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-511s21c1
Sequence:CCGGAGGAGTTGTTGGATGGGATTCCTCGAGGAATCCCATCCAACAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-296s21c1
Sequence:CCGGCGTAGGAGCACTGAGCTTGAACTCGAGTTCAAGCTCAGTGCTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030769.1-1329s21c1
Sequence:CCGGCTCTGGTTCCTAATCCTATTTCTCGAGAAATAGGATTAGGAACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030769.1-1039s21c1
Sequence:CCGGGAGACATAATCTACCTTAAATCTCGAGATTTAAGGTAGATTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-786s21c1
Sequence:CCGGTGTATCCAGAGATTTATCAACCTCGAGGTTGATAAATCTCTGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030769
VALIDATED
NPL MISSION shRNA shRNA Plasmid DNA
N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-758s1c1
Sequence:CCGGCTTCTCTTTAGCCCTGAACTACTCGAGTAGTTCAGGGCTAAAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-333s1c1
Sequence:CCGGGCCCAACATGCAGCAGAAATACTCGAGTATTTCTGCTGCATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-557s1c1
Sequence:CCGGGCTGAAATTCAGTGATACAGACTCGAGTCTGTATCACTGAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-915s1c1
Sequence:CCGGGAGTTTACTGATAGTGCTGAACTCGAGTTCAGCACTATCAGTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-96s1c1
Sequence:CCGGCCAATGACTGAGAATGGAGAACTCGAGTTCTCCATTCTCAGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-367s21c1
Sequence:CCGGTCGCTGTCATTGCACCGTTCTCTCGAGAGAACGGTGCAATGACAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-511s21c1
Sequence:CCGGAGGAGTTGTTGGATGGGATTCCTCGAGGAATCCCATCCAACAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-296s21c1
Sequence:CCGGCGTAGGAGCACTGAGCTTGAACTCGAGTTCAAGCTCAGTGCTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030769.1-1329s21c1
Sequence:CCGGCTCTGGTTCCTAATCCTATTTCTCGAGAAATAGGATTAGGAACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030769.1-1039s21c1
Sequence:CCGGGAGACATAATCTACCTTAAATCTCGAGATTTAAGGTAGATTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-786s21c1
Sequence:CCGGTGTATCCAGAGATTTATCAACCTCGAGGTTGATAAATCTCTGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030769
VALIDATED
NPL MISSION shRNA Lentiviral Transduction Particles
N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-758s1c1
Sequence:CCGGCTTCTCTTTAGCCCTGAACTACTCGAGTAGTTCAGGGCTAAAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-333s1c1
Sequence:CCGGGCCCAACATGCAGCAGAAATACTCGAGTATTTCTGCTGCATGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-557s1c1
Sequence:CCGGGCTGAAATTCAGTGATACAGACTCGAGTCTGTATCACTGAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-915s1c1
Sequence:CCGGGAGTTTACTGATAGTGCTGAACTCGAGTTCAGCACTATCAGTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_030769.1-96s1c1
Sequence:CCGGCCAATGACTGAGAATGGAGAACTCGAGTTCTCCATTCTCAGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-367s21c1
Sequence:CCGGTCGCTGTCATTGCACCGTTCTCTCGAGAGAACGGTGCAATGACAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-511s21c1
Sequence:CCGGAGGAGTTGTTGGATGGGATTCCTCGAGGAATCCCATCCAACAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-296s21c1
Sequence:CCGGCGTAGGAGCACTGAGCTTGAACTCGAGTTCAAGCTCAGTGCTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030769.1-1329s21c1
Sequence:CCGGCTCTGGTTCCTAATCCTATTTCTCGAGAAATAGGATTAGGAACCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030769.1-1039s21c1
Sequence:CCGGGAGACATAATCTACCTTAAATCTCGAGATTTAAGGTAGATTATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030769.1-786s21c1
Sequence:CCGGTGTATCCAGAGATTTATCAACCTCGAGGTTGATAAATCTCTGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks