EMAIL THIS PAGE TO A FRIEND

NPY6R

neuropeptide Y receptor Y6 (pseudogene)

Synonyms: NPY1RL NPY6RP PP2 Y2B
UniProtKB ID: Q99463, D3DQB4
Gene ID:
Mouse(18169) neuropeptide Y receptor Y6
Domestic Rabbit(100009561) neuropeptide Y/peptide YY Y6 receptor
chicken(693264) neuropeptide Y receptor Y6 (pseudogene)
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002713 Rosetta Predictions human pricing
NM_010935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376333 predicted 769
2 SASI_Hs02_00376334 predicted 1515
3 SASI_Hs02_00376335 predicted 1113
4 SASI_Hs02_00376336 predicted 955
5 SASI_Hs02_00376337 predicted 218
6 SASI_Hs02_00376338 predicted 1523
7 SASI_Hs02_00376339 predicted 829
8 SASI_Hs02_00376340 predicted 1671
9 SASI_Hs02_00376341 predicted 216
10 SASI_Hs02_00376342 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027293 predicted 1573
2 SASI_Mm01_00027294 predicted 705
3 SASI_Mm01_00027295 predicted 901
4 SASI_Mm01_00027296 predicted 1475
5 SASI_Mm01_00027297 predicted 1138
6 SASI_Mm01_00027298 predicted 980
7 SASI_Mm01_00027299 predicted 866
8 SASI_Mm01_00027300 predicted 967
9 SASI_Mm01_00027301 predicted 613
10 SASI_Mm01_00027302 predicted 1268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010935
NPY6R MISSION shRNA Bacterial Glycerol Stock
neuropeptide Y receptor Y6 (pseudogene)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-819s1c1
Sequence:CCGGCCAGAGTAGCTCATGCCTATTCTCGAGAATAGGCATGAGCTACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-1042s1c1
Sequence:CCGGCCCTCTGGGTTTCATTCTTATCTCGAGATAAGAATGAAACCCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-1290s1c1
Sequence:CCGGGCCACTTGATTGCTATGGTTTCTCGAGAAACCATAGCAATCAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-512s1c1
Sequence:CCGGGTGATCCTAATCATGGGCATTCTCGAGAATGCCCATGATTAGGATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010935.2-1580s1c1
Sequence:CCGGGCCAGACTTAAACACATAATACTCGAGTATTATGTGTTTAAGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010935.3-1141s21c1
Sequence:CCGGATGAGAACAAGAGGGTAAATGCTCGAGCATTTACCCTCTTGTTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010935.3-766s21c1
Sequence:CCGGTGATTGCTATTGAACGATATCCTCGAGGATATCGTTCAATAGCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010935.3-1906s21c1
Sequence:CCCGACTTGCAATCACATAACTATTCTCGAGAATAGTTATGTGATTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010935
NPY6R MISSION shRNA shRNA Plasmid DNA
neuropeptide Y receptor Y6 (pseudogene)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-819s1c1
Sequence:CCGGCCAGAGTAGCTCATGCCTATTCTCGAGAATAGGCATGAGCTACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-1042s1c1
Sequence:CCGGCCCTCTGGGTTTCATTCTTATCTCGAGATAAGAATGAAACCCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-1290s1c1
Sequence:CCGGGCCACTTGATTGCTATGGTTTCTCGAGAAACCATAGCAATCAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-512s1c1
Sequence:CCGGGTGATCCTAATCATGGGCATTCTCGAGAATGCCCATGATTAGGATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010935.2-1580s1c1
Sequence:CCGGGCCAGACTTAAACACATAATACTCGAGTATTATGTGTTTAAGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010935.3-1141s21c1
Sequence:CCGGATGAGAACAAGAGGGTAAATGCTCGAGCATTTACCCTCTTGTTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010935.3-766s21c1
Sequence:CCGGTGATTGCTATTGAACGATATCCTCGAGGATATCGTTCAATAGCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010935.3-1906s21c1
Sequence:CCCGACTTGCAATCACATAACTATTCTCGAGAATAGTTATGTGATTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010935
NPY6R MISSION shRNA Lentiviral Transduction Particles
neuropeptide Y receptor Y6 (pseudogene)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-819s1c1
Sequence:CCGGCCAGAGTAGCTCATGCCTATTCTCGAGAATAGGCATGAGCTACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-1042s1c1
Sequence:CCGGCCCTCTGGGTTTCATTCTTATCTCGAGATAAGAATGAAACCCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-1290s1c1
Sequence:CCGGGCCACTTGATTGCTATGGTTTCTCGAGAAACCATAGCAATCAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010935.2-512s1c1
Sequence:CCGGGTGATCCTAATCATGGGCATTCTCGAGAATGCCCATGATTAGGATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010935.2-1580s1c1
Sequence:CCGGGCCAGACTTAAACACATAATACTCGAGTATTATGTGTTTAAGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010935.3-1141s21c1
Sequence:CCGGATGAGAACAAGAGGGTAAATGCTCGAGCATTTACCCTCTTGTTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010935.3-766s21c1
Sequence:CCGGTGATTGCTATTGAACGATATCCTCGAGGATATCGTTCAATAGCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010935.3-1906s21c1
Sequence:CCCGACTTGCAATCACATAACTATTCTCGAGAATAGTTATGTGATTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks