EMAIL THIS PAGE TO A FRIEND

NR2F6

nuclear receptor subfamily 2, group F, member 6

Synonyms: EAR-2 EAR2 ERBAL2
UniProtKB ID: P10588, B2RC68, Q5XGA0, Q6P586, Q9BUE8
Gene ID:
Mouse(13864) nuclear receptor subfamily 2, group F, member 6
Rat(245980) nuclear receptor subfamily 2, group F, member 6
chicken(474359) nuclear receptor subfamily 2, group F, member 6
dog(609720) nuclear receptor subfamily 2, group F, member 6
cow(100296331) nuclear receptor subfamily 2, group F, member 6
domestic cat(101082297) nuclear receptor subfamily 2, group F, member 6
sheep(101113931) nuclear receptor subfamily 2, group F, member 6
naked mole-rat(101723372) nuclear receptor subfamily 2, group F, member 6
domestic guinea pig(100732179) nuclear receptor subfamily 2, group F, member 6
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N7664 Anti-NR2F6 (281-293) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV32256 Anti-NR2F6 (AB1) antibody produced in rabbit affinity isolated antibody canine, mouse, rat, human, guinea pig
immunohistochemistry, western blot pricing
AV45627 Anti-NR2F6 (AB2) antibody produced in rabbit affinity isolated antibody mouse, canine, human, guinea pig, rat
western blot pricing
AV32995 Anti-NR2F6 antibody produced in rabbit IgG fraction of antiserum mouse, human, rat, canine, guinea pig, zebrafish
western blot pricing
SAB4500781 Anti-NR2F6, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU092041 MISSION® esiRNA esiRNA targeting mouse Nr2f6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005234 Rosetta Predictions human pricing
NM_139113 Rosetta Predictions rat pricing
NM_010150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080216 predicted 1017
2 SASI_Hs01_00080218 predicted 1257
3 SASI_Hs01_00080219 predicted 1026
4 SASI_Hs01_00080220 predicted 391
5 SASI_Hs01_00080221 predicted 1375
6 SASI_Hs01_00080222 predicted 1255
7 SASI_Hs01_00080223 predicted 442
8 SASI_Hs01_00080224 predicted 390
9 SASI_Hs01_00080225 predicted 403
10 SASI_Hs02_00339238 predicted 1512
11 SASI_Hs01_00080217 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049387 predicted 499
2 SASI_Rn01_00049388 predicted 1160
3 SASI_Rn01_00049389 predicted 1082
4 SASI_Rn01_00049390 predicted 1170
5 SASI_Rn01_00049391 predicted 486
6 SASI_Rn01_00049392 predicted 1362
7 SASI_Rn01_00049393 predicted 416
8 SASI_Rn01_00049394 predicted 1313
9 SASI_Rn01_00049395 predicted 1339
10 SASI_Rn02_00268496 predicted 531
11 SASI_Rn01_00049386 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073566 predicted 1833
2 SASI_Mm01_00073567 predicted 1629
3 SASI_Mm01_00073568 predicted 966
4 SASI_Mm01_00073569 predicted 1544
5 SASI_Mm01_00073570 predicted 858
6 SASI_Mm01_00073571 predicted 1223
7 SASI_Mm01_00073572 predicted 1828
8 SASI_Mm01_00073573 predicted 957
9 SASI_Mm01_00073574 predicted 1950
10 SASI_Mm01_00073575 predicted 1353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005234
VALIDATED
NR2F6 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 2, group F, member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-161s1c1
Sequence:CCGGCGACACGAACGGCGTGGACAACTCGAGTTGTCCACGCCGTTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-314s1c1
Sequence:CCGGCGGCAAGCATTACGGTGTCTTCTCGAGAAGACACCGTAATGCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-1613s1c1
Sequence:CCGGCCTAGCATGAACTTGTGGGATCTCGAGATCCCACAAGTTCATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-1268s1c1
Sequence:CCGGTGAGACACTGATCAGAGACATCTCGAGATGTCTCTGATCAGTGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-947s1c1
Sequence:CCGGCGTGGCTTTCATGGACCAGGTCTCGAGACCTGGTCCATGAAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005234.3-161s21c1
Sequence:CCGGCGACACGAACGGCGTGGACAACTCGAGTTGTCCACGCCGTTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005234.3-947s21c1
Sequence:CCGGCGTGGCTTTCATGGACCAGGTCTCGAGACCTGGTCCATGAAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005234.3-1268s21c1
Sequence:CCGGTGAGACACTGATCAGAGACATCTCGAGATGTCTCTGATCAGTGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005234.3-314s21c1
Sequence:CCGGCGGCAAGCATTACGGTGTCTTCTCGAGAAGACACCGTAATGCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005234.3-1440s21c1
Sequence:CCGGTTCTCTCCTCAGACTTCTATTCTCGAGAATAGAAGTCTGAGGAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005234
VALIDATED
NR2F6 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 2, group F, member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-161s1c1
Sequence:CCGGCGACACGAACGGCGTGGACAACTCGAGTTGTCCACGCCGTTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-314s1c1
Sequence:CCGGCGGCAAGCATTACGGTGTCTTCTCGAGAAGACACCGTAATGCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-1613s1c1
Sequence:CCGGCCTAGCATGAACTTGTGGGATCTCGAGATCCCACAAGTTCATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-1268s1c1
Sequence:CCGGTGAGACACTGATCAGAGACATCTCGAGATGTCTCTGATCAGTGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-947s1c1
Sequence:CCGGCGTGGCTTTCATGGACCAGGTCTCGAGACCTGGTCCATGAAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005234.3-161s21c1
Sequence:CCGGCGACACGAACGGCGTGGACAACTCGAGTTGTCCACGCCGTTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005234.3-947s21c1
Sequence:CCGGCGTGGCTTTCATGGACCAGGTCTCGAGACCTGGTCCATGAAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005234.3-1268s21c1
Sequence:CCGGTGAGACACTGATCAGAGACATCTCGAGATGTCTCTGATCAGTGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005234.3-314s21c1
Sequence:CCGGCGGCAAGCATTACGGTGTCTTCTCGAGAAGACACCGTAATGCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005234.3-1440s21c1
Sequence:CCGGTTCTCTCCTCAGACTTCTATTCTCGAGAATAGAAGTCTGAGGAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005234
VALIDATED
NR2F6 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 2, group F, member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-161s1c1
Sequence:CCGGCGACACGAACGGCGTGGACAACTCGAGTTGTCCACGCCGTTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-314s1c1
Sequence:CCGGCGGCAAGCATTACGGTGTCTTCTCGAGAAGACACCGTAATGCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-1613s1c1
Sequence:CCGGCCTAGCATGAACTTGTGGGATCTCGAGATCCCACAAGTTCATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-1268s1c1
Sequence:CCGGTGAGACACTGATCAGAGACATCTCGAGATGTCTCTGATCAGTGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005234.3-947s1c1
Sequence:CCGGCGTGGCTTTCATGGACCAGGTCTCGAGACCTGGTCCATGAAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005234.3-161s21c1
Sequence:CCGGCGACACGAACGGCGTGGACAACTCGAGTTGTCCACGCCGTTCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005234.3-947s21c1
Sequence:CCGGCGTGGCTTTCATGGACCAGGTCTCGAGACCTGGTCCATGAAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005234.3-1268s21c1
Sequence:CCGGTGAGACACTGATCAGAGACATCTCGAGATGTCTCTGATCAGTGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005234.3-314s21c1
Sequence:CCGGCGGCAAGCATTACGGTGTCTTCTCGAGAAGACACCGTAATGCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005234.3-1440s21c1
Sequence:CCGGTTCTCTCCTCAGACTTCTATTCTCGAGAATAGAAGTCTGAGGAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010150
VALIDATED
NR2F6 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 2, group F, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-1241s1c1
Sequence:CCGGTCTGTCAGGGAGCACCTTTAACTCGAGTTAAAGGTGCTCCCTGACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-298s1c1
Sequence:CCGGACAAGTCCAGTGGAAAGCATTCTCGAGAATGCTTTCCACTGGACTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-396s1c1
Sequence:CCGGTCCAACCGTGACTGTCAGATTCTCGAGAATCTGACAGTCACGGTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010150.1-956s1c1
Sequence:CCGGGCAGGTGGATGCTGCGGAGTACTCGAGTACTCCGCAGCATCCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-1181s1c1
Sequence:CCGGGCTCTTCTTCATGCGCTTGGTCTCGAGACCAAGCGCATGAAGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010150
VALIDATED
NR2F6 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 2, group F, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-1241s1c1
Sequence:CCGGTCTGTCAGGGAGCACCTTTAACTCGAGTTAAAGGTGCTCCCTGACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-298s1c1
Sequence:CCGGACAAGTCCAGTGGAAAGCATTCTCGAGAATGCTTTCCACTGGACTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-396s1c1
Sequence:CCGGTCCAACCGTGACTGTCAGATTCTCGAGAATCTGACAGTCACGGTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010150.1-956s1c1
Sequence:CCGGGCAGGTGGATGCTGCGGAGTACTCGAGTACTCCGCAGCATCCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-1181s1c1
Sequence:CCGGGCTCTTCTTCATGCGCTTGGTCTCGAGACCAAGCGCATGAAGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010150
VALIDATED
NR2F6 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 2, group F, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-1241s1c1
Sequence:CCGGTCTGTCAGGGAGCACCTTTAACTCGAGTTAAAGGTGCTCCCTGACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-298s1c1
Sequence:CCGGACAAGTCCAGTGGAAAGCATTCTCGAGAATGCTTTCCACTGGACTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-396s1c1
Sequence:CCGGTCCAACCGTGACTGTCAGATTCTCGAGAATCTGACAGTCACGGTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010150.1-956s1c1
Sequence:CCGGGCAGGTGGATGCTGCGGAGTACTCGAGTACTCCGCAGCATCCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010150.1-1181s1c1
Sequence:CCGGGCTCTTCTTCATGCGCTTGGTCTCGAGACCAAGCGCATGAAGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks