EMAIL THIS PAGE TO A FRIEND

NR6A1

nuclear receptor subfamily 6, group A, member 1

Synonyms: GCNF GCNF1 NR61 RTR hGCNF hRTR
Gene ID:
Human(2649) Summary: This gene encodes an orphan nuclear receptor which is a member of the nuclear hormone receptor family. Its expression pattern suggests that it may be involved in neurogenesis and germ cell development. The protein can homodimerize and bind DNA, but in vivo targets have not been identified. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2013]
Mouse(14536) nuclear receptor subfamily 6, group A, member 1
Rat(362125) nuclear receptor subfamily 6, group A, member 1
chicken(772325) nuclear receptor subfamily 6, group A, member 1
cow(541257) nuclear receptor subfamily 6, group A, member 1
sheep(100302637) nuclear receptor subfamily 6, group A, member 1
naked mole-rat(101718322) nuclear receptor subfamily 6, group A, member 1
domestic guinea pig(100734260) nuclear receptor subfamily 6, group A, member 1
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001489 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001489 Rosetta Predictions human pricing
NM_033334 Rosetta Predictions human pricing
NM_033335 Rosetta Predictions human pricing
XM_001060553 Rosetta Predictions rat pricing
XM_342427 Rosetta Predictions rat pricing
NM_010264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106946 predicted 1414
2 SASI_Hs01_00106947 predicted 1485
3 SASI_Hs01_00106948 predicted 1146
4 SASI_Hs02_00331974 predicted 1466
5 SASI_Hs01_00106949 predicted 986
6 SASI_Hs01_00106950 predicted 1272
7 SASI_Hs01_00106951 predicted 1454
8 SASI_Hs01_00106952 predicted 1237
9 SASI_Hs01_00106953 predicted 1322
10 SASI_Hs01_00106954 predicted 1403
11 SASI_Hs01_00106955 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185248 predicted 1428
2 SASI_Hs01_00185249 predicted 1503
3 SASI_Hs01_00185250 predicted 1155
4 SASI_Hs02_00361186 predicted 1481
5 SASI_Hs01_00185251 predicted 1006
6 SASI_Hs01_00185252 predicted 1285
7 SASI_Hs01_00185253 predicted 1467
8 SASI_Hs01_00185254 predicted 1256
9 SASI_Hs01_00185255 predicted 1337
10 SASI_Hs01_00185256 predicted 1419
11 SASI_Hs01_00185257 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083585 predicted 1356
2 SASI_Hs01_00083586 predicted 1433
3 SASI_Hs01_00083587 predicted 1084
4 SASI_Hs01_00083588 predicted 931
5 SASI_Hs01_00083589 predicted 1211
6 SASI_Hs01_00083590 predicted 1388
7 SASI_Hs01_00083591 predicted 1183
8 SASI_Hs01_00083592 predicted 1269
9 SASI_Hs01_00083593 predicted 1346
10 SASI_Hs01_00083594 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296992 predicted 1229
2 SASI_Rn02_00296993 predicted 1113
3 SASI_Rn02_00296994 predicted 785
4 SASI_Rn02_00296995 predicted 1380
5 SASI_Rn02_00296996 predicted 486
6 SASI_Rn02_00296997 predicted 1144
7 SASI_Rn02_00296998 predicted 557
8 SASI_Rn02_00296999 predicted 1014
9 SASI_Rn02_00297000 predicted 282
10 SASI_Rn02_00297001 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394259 predicted 1586
2 SASI_Rn02_00394260 predicted 1568
3 SASI_Rn02_00394261 predicted 1051
4 SASI_Rn02_00394262 predicted 1515
5 SASI_Rn02_00394263 predicted 1144
6 SASI_Rn02_00394264 predicted 1005
7 SASI_Rn02_00394265 predicted 1522
8 SASI_Rn02_00394266 predicted 1074
9 SASI_Rn02_00394267 predicted 1152
10 SASI_Rn02_00394268 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025192 predicted 797
2 SASI_Mm01_00025194 predicted 851
3 SASI_Mm01_00025195 predicted 704
4 SASI_Mm01_00025196 predicted 539
5 SASI_Mm01_00025197 predicted 519
6 SASI_Mm02_00318168 predicted 1098
7 SASI_Mm01_00025198 predicted 1508
8 SASI_Mm01_00025199 predicted 1075
9 SASI_Mm01_00025200 predicted 1740
10 SASI_Mm01_00025201 predicted 1547
11 SASI_Mm01_00025193 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010264
NR6A1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 6, group A, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-1734s1c1
Sequence:CCGGCCAAACCGCTTTCCTGATCTTCTCGAGAAGATCAGGAAAGCGGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-1027s1c1
Sequence:CCGGCCAGTAGGTCTGTGGAACTAACTCGAGTTAGTTCCACAGACCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-859s1c1
Sequence:CCGGGCATTGGACCAGTCCAGATATCTCGAGATATCTGGACTGGTCCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-1091s1c1
Sequence:CCGGGCCTCCACATTATCAATACATCTCGAGATGTATTGATAATGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-585s1c1
Sequence:CCGGCCAGATGATCGAGCTGAACAACTCGAGTTGTTCAGCTCGATCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010264
NR6A1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 6, group A, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-1734s1c1
Sequence:CCGGCCAAACCGCTTTCCTGATCTTCTCGAGAAGATCAGGAAAGCGGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-1027s1c1
Sequence:CCGGCCAGTAGGTCTGTGGAACTAACTCGAGTTAGTTCCACAGACCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-859s1c1
Sequence:CCGGGCATTGGACCAGTCCAGATATCTCGAGATATCTGGACTGGTCCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-1091s1c1
Sequence:CCGGGCCTCCACATTATCAATACATCTCGAGATGTATTGATAATGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-585s1c1
Sequence:CCGGCCAGATGATCGAGCTGAACAACTCGAGTTGTTCAGCTCGATCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010264
NR6A1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 6, group A, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-1734s1c1
Sequence:CCGGCCAAACCGCTTTCCTGATCTTCTCGAGAAGATCAGGAAAGCGGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-1027s1c1
Sequence:CCGGCCAGTAGGTCTGTGGAACTAACTCGAGTTAGTTCCACAGACCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-859s1c1
Sequence:CCGGGCATTGGACCAGTCCAGATATCTCGAGATATCTGGACTGGTCCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-1091s1c1
Sequence:CCGGGCCTCCACATTATCAATACATCTCGAGATGTATTGATAATGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010264.2-585s1c1
Sequence:CCGGCCAGATGATCGAGCTGAACAACTCGAGTTGTTCAGCTCGATCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001489
NR6A1 MISSION shRNA Bacterial Glycerol Stock
nuclear receptor subfamily 6, group A, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001489.2-831s1c1
Sequence:CCGGGCCTCCACATTACCAATATATCTCGAGATATATTGGTAATGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001489.2-553s1c1
Sequence:CCGGCGGAAGGCTATCAGAGAAGATCTCGAGATCTTCTCTGATAGCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001489.2-1101s1c1
Sequence:CCGGCGAGCTCTCAATCAAGGATTACTCGAGTAATCCTTGATTGAGAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-1150s21c1
Sequence:CCGGGCTGTCTTCCCTCACCGTTTACTCGAGTAAACGGTGAGGGAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-592s21c1
Sequence:CCGGCATTGGGCCAGTCCAGATATCCTCGAGGATATCTGGACTGGCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-504s21c1
Sequence:CCGGAGTACTGCCGCCTGCTCAAATCTCGAGATTTGAGCAGGCGGCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-420s21c1
Sequence:CCGGAGCGGAGCATTTGCAACAAACCTCGAGGTTTGTTGCAAATGCTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001489
NR6A1 MISSION shRNA shRNA Plasmid DNA
nuclear receptor subfamily 6, group A, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001489.2-831s1c1
Sequence:CCGGGCCTCCACATTACCAATATATCTCGAGATATATTGGTAATGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001489.2-553s1c1
Sequence:CCGGCGGAAGGCTATCAGAGAAGATCTCGAGATCTTCTCTGATAGCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001489.2-1101s1c1
Sequence:CCGGCGAGCTCTCAATCAAGGATTACTCGAGTAATCCTTGATTGAGAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-1150s21c1
Sequence:CCGGGCTGTCTTCCCTCACCGTTTACTCGAGTAAACGGTGAGGGAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-592s21c1
Sequence:CCGGCATTGGGCCAGTCCAGATATCCTCGAGGATATCTGGACTGGCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-504s21c1
Sequence:CCGGAGTACTGCCGCCTGCTCAAATCTCGAGATTTGAGCAGGCGGCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-420s21c1
Sequence:CCGGAGCGGAGCATTTGCAACAAACCTCGAGGTTTGTTGCAAATGCTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001489
NR6A1 MISSION shRNA Lentiviral Transduction Particles
nuclear receptor subfamily 6, group A, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001489.2-831s1c1
Sequence:CCGGGCCTCCACATTACCAATATATCTCGAGATATATTGGTAATGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001489.2-553s1c1
Sequence:CCGGCGGAAGGCTATCAGAGAAGATCTCGAGATCTTCTCTGATAGCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001489.2-1101s1c1
Sequence:CCGGCGAGCTCTCAATCAAGGATTACTCGAGTAATCCTTGATTGAGAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-1150s21c1
Sequence:CCGGGCTGTCTTCCCTCACCGTTTACTCGAGTAAACGGTGAGGGAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-592s21c1
Sequence:CCGGCATTGGGCCAGTCCAGATATCCTCGAGGATATCTGGACTGGCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-504s21c1
Sequence:CCGGAGTACTGCCGCCTGCTCAAATCTCGAGATTTGAGCAGGCGGCAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001489.3-420s21c1
Sequence:CCGGAGCGGAGCATTTGCAACAAACCTCGAGGTTTGTTGCAAATGCTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks