EMAIL THIS PAGE TO A FRIEND

NRAS

neuroblastoma RAS viral (v-ras) oncogene homolog

Synonyms: ALPS4 N-ras NRAS1 NS6
UniProtKB ID: P01111, Q14971, Q15104, Q15282
Gene ID:
Human(4893) Summary: This is an N-ras oncogene encoding a membrane protein that shuttles between the Golgi apparatus and the plasma membrane. This shuttling is regulated through palmitoylation and depalmitoylation by the ZDHHC9-GOLGA7 complex. The encoded protein, which has intrinsic GTPase activity, is activated by a guanine nucleotide-exchange factor and inactivated by a GTPase activating protein. Mutations in this gene have been associated with somatic rectal cancer, follicular thyroid cancer, autoimmune lymphoproliferative syndrome, Noonan syndrome, and juvenile myelomonocytic leukemia. [provided by RefSeq, Jun 2011]
Mouse(18176) neuroblastoma ras oncogene
Rat(24605) neuroblastoma ras oncogene
Zebrafish(30380) neuroblastoma RAS viral (v-ras) oncogene homolog
cow(506322) neuroblastoma RAS viral (v-ras) oncogene homolog
dog(403872) neuroblastoma RAS viral (v-ras) oncogene homolog
chicken(419885) neuroblastoma RAS viral (v-ras) oncogene homolog
sheep(101102438) neuroblastoma RAS viral (v-ras) oncogene homolog
domestic guinea pig(100135584) neuroblastoma ras oncogene
naked mole-rat(101719269) neuroblastoma RAS viral (v-ras) oncogene homolog
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002524 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224041 MISSION® esiRNA esiRNA targeting human NRAS human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002524 Rosetta Predictions human pricing
NM_080766 Rosetta Predictions rat pricing
XM_579607 Rosetta Predictions rat pricing
NM_010937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017654 predicted 328
2 SASI_Hs01_00017655 predicted 801
3 SASI_Hs01_00017656 predicted 855
4 SASI_Hs02_00333996 predicted 856
5 SASI_Hs01_00017657 predicted 310
6 SASI_Hs01_00017658 predicted 609
7 SASI_Hs01_00017659 predicted 737
8 SASI_Hs01_00017660 predicted 955
9 SASI_Hs01_00017662 predicted 901
10 SASI_Hs01_00017663 predicted 783
11 SASI_Hs01_00017661 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075695 predicted 202
2 SASI_Rn02_00267287 predicted 1018
3 SASI_Rn02_00267288 predicted 1015
4 SASI_Rn02_00267289 predicted 402
5 SASI_Rn01_00075697 predicted 824
6 SASI_Rn01_00075698 predicted 505
7 SASI_Rn01_00075699 predicted 456
8 SASI_Rn01_00075703 predicted 232
9 SASI_Rn01_00075704 predicted 446
10 SASI_Rn02_00267290 predicted 585
11 SASI_Rn01_00075696 predicted 439
12 SASI_Rn01_00075700 predicted 448
13 SASI_Rn01_00075701 predicted 199
14 SASI_Rn01_00075702 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168554 predicted 245
2 SASI_Rn01_00168555 predicted 444
3 SASI_Rn01_00168556 predicted 869
4 SASI_Rn01_00168557 predicted 545
5 SASI_Rn01_00168558 predicted 494
6 SASI_Rn01_00168559 predicted 449
7 SASI_Rn01_00168560 predicted 198
8 SASI_Rn01_00168561 predicted 380
9 SASI_Rn01_00168562 predicted 275
10 SASI_Rn01_00168563 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319691 predicted 652
2 SASI_Mm01_00129592 predicted 289
3 SASI_Mm01_00129597 predicted 646
4 SASI_Mm01_00129594 predicted 277
5 SASI_Mm02_00319692 predicted 463
6 SASI_Mm01_00129596 predicted 529
7 SASI_Mm01_00129599 predicted 579
8 SASI_Mm02_00319693 predicted 733
9 SASI_Mm01_00129600 predicted 517
10 SASI_Mm01_00129601 predicted 469
11 SASI_Mm01_00129593 predicted 299
12 SASI_Mm01_00129595 predicted 944
13 SASI_Mm01_00129598 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010937
VALIDATED
NRAS MISSION shRNA Bacterial Glycerol Stock
neuroblastoma RAS viral (v-ras) oncogene homolog
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-321s1c1
Sequence:CCGGCCATAGAGGATTCTTACCGAACTCGAGTTCGGTAAGAATCCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-742s1c1
Sequence:CCGGCGATGGCACTCAAGGTTGTATCTCGAGATACAACCTTGAGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-338s1c1
Sequence:CCGGCGAAAGCAAGTGGTGATTGATCTCGAGATCAATCACCACTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-441s1c1
Sequence:CCGGGCGAAGGGTTCCTCTGTGTATCTCGAGATACACAGAGGAACCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-777s1c1
Sequence:CCGGTGCTGATGTGTAAGACACTTTCTCGAGAAAGTGTCTTACACATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-277s21c1
Sequence:CCGGCCATAGAGGATTCTTACCGAACTCGAGTTCGGTAAGAATCCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-397s21c1
Sequence:CCGGGCGAAGGGTTCCTCTGTGTATCTCGAGATACACAGAGGAACCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-455s21c1
Sequence:CCGGCCTCTACAGGGAGCAAATTAACTCGAGTTAATTTGCTCCCTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010937.2-1236s21c1
Sequence:CCGGTGTAATGTGATCAGCTATATTCTCGAGAATATAGCTGATCACATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-698s21c1
Sequence:CCGGCGATGGCACTCAAGGTTGTATCTCGAGATACAACCTTGAGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010937
VALIDATED
NRAS MISSION shRNA shRNA Plasmid DNA
neuroblastoma RAS viral (v-ras) oncogene homolog
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-321s1c1
Sequence:CCGGCCATAGAGGATTCTTACCGAACTCGAGTTCGGTAAGAATCCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-742s1c1
Sequence:CCGGCGATGGCACTCAAGGTTGTATCTCGAGATACAACCTTGAGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-338s1c1
Sequence:CCGGCGAAAGCAAGTGGTGATTGATCTCGAGATCAATCACCACTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-441s1c1
Sequence:CCGGGCGAAGGGTTCCTCTGTGTATCTCGAGATACACAGAGGAACCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-777s1c1
Sequence:CCGGTGCTGATGTGTAAGACACTTTCTCGAGAAAGTGTCTTACACATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-277s21c1
Sequence:CCGGCCATAGAGGATTCTTACCGAACTCGAGTTCGGTAAGAATCCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-397s21c1
Sequence:CCGGGCGAAGGGTTCCTCTGTGTATCTCGAGATACACAGAGGAACCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-455s21c1
Sequence:CCGGCCTCTACAGGGAGCAAATTAACTCGAGTTAATTTGCTCCCTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010937.2-1236s21c1
Sequence:CCGGTGTAATGTGATCAGCTATATTCTCGAGAATATAGCTGATCACATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-698s21c1
Sequence:CCGGCGATGGCACTCAAGGTTGTATCTCGAGATACAACCTTGAGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010937
VALIDATED
NRAS MISSION shRNA Lentiviral Transduction Particles
neuroblastoma RAS viral (v-ras) oncogene homolog
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-321s1c1
Sequence:CCGGCCATAGAGGATTCTTACCGAACTCGAGTTCGGTAAGAATCCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-742s1c1
Sequence:CCGGCGATGGCACTCAAGGTTGTATCTCGAGATACAACCTTGAGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-338s1c1
Sequence:CCGGCGAAAGCAAGTGGTGATTGATCTCGAGATCAATCACCACTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-441s1c1
Sequence:CCGGGCGAAGGGTTCCTCTGTGTATCTCGAGATACACAGAGGAACCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010937.1-777s1c1
Sequence:CCGGTGCTGATGTGTAAGACACTTTCTCGAGAAAGTGTCTTACACATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-277s21c1
Sequence:CCGGCCATAGAGGATTCTTACCGAACTCGAGTTCGGTAAGAATCCTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-397s21c1
Sequence:CCGGGCGAAGGGTTCCTCTGTGTATCTCGAGATACACAGAGGAACCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-455s21c1
Sequence:CCGGCCTCTACAGGGAGCAAATTAACTCGAGTTAATTTGCTCCCTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010937.2-1236s21c1
Sequence:CCGGTGTAATGTGATCAGCTATATTCTCGAGAATATAGCTGATCACATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010937.2-698s21c1
Sequence:CCGGCGATGGCACTCAAGGTTGTATCTCGAGATACAACCTTGAGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002524
VALIDATED
NRAS MISSION shRNA Bacterial Glycerol Stock
neuroblastoma RAS viral (v-ras) oncogene homolog
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002524.2-445s1c1
Sequence:CCGGCAGTGCCATGAGAGACCAATACTCGAGTATTGGTCTCTCATGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002524.2-398s1c1
Sequence:CCGGGAAACCTGTTTGTTGGACATACTCGAGTATGTCCAACAAACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002524.3-502s21c1
Sequence:CCGGCCATCAATAATAGCAAGTCATCTCGAGATGACTTGCTATTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-446s21c1
Sequence:CCGGCAGTGCCATGAGAGACCAATACTCGAGTATTGGTCTCTCATGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-656s21c1
Sequence:CCGGCAAGAGTTACGGGATTCCATTCTCGAGAATGGAATCCCGTAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-305s21c1
Sequence:CCGGCGCACTGACAATCCAGCTAATCTCGAGATTAGCTGGATTGTCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-399s21c1
Sequence:CCGGGAAACCTGTTTGTTGGACATACTCGAGTATGTCCAACAAACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002524
VALIDATED
NRAS MISSION shRNA shRNA Plasmid DNA
neuroblastoma RAS viral (v-ras) oncogene homolog
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002524.2-445s1c1
Sequence:CCGGCAGTGCCATGAGAGACCAATACTCGAGTATTGGTCTCTCATGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002524.2-398s1c1
Sequence:CCGGGAAACCTGTTTGTTGGACATACTCGAGTATGTCCAACAAACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002524.3-502s21c1
Sequence:CCGGCCATCAATAATAGCAAGTCATCTCGAGATGACTTGCTATTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-446s21c1
Sequence:CCGGCAGTGCCATGAGAGACCAATACTCGAGTATTGGTCTCTCATGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-656s21c1
Sequence:CCGGCAAGAGTTACGGGATTCCATTCTCGAGAATGGAATCCCGTAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-305s21c1
Sequence:CCGGCGCACTGACAATCCAGCTAATCTCGAGATTAGCTGGATTGTCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-399s21c1
Sequence:CCGGGAAACCTGTTTGTTGGACATACTCGAGTATGTCCAACAAACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002524
VALIDATED
NRAS MISSION shRNA Lentiviral Transduction Particles
neuroblastoma RAS viral (v-ras) oncogene homolog
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002524.2-445s1c1
Sequence:CCGGCAGTGCCATGAGAGACCAATACTCGAGTATTGGTCTCTCATGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002524.2-398s1c1
Sequence:CCGGGAAACCTGTTTGTTGGACATACTCGAGTATGTCCAACAAACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002524.3-502s21c1
Sequence:CCGGCCATCAATAATAGCAAGTCATCTCGAGATGACTTGCTATTATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-446s21c1
Sequence:CCGGCAGTGCCATGAGAGACCAATACTCGAGTATTGGTCTCTCATGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-656s21c1
Sequence:CCGGCAAGAGTTACGGGATTCCATTCTCGAGAATGGAATCCCGTAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-305s21c1
Sequence:CCGGCGCACTGACAATCCAGCTAATCTCGAGATTAGCTGGATTGTCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002524.3-399s21c1
Sequence:CCGGGAAACCTGTTTGTTGGACATACTCGAGTATGTCCAACAAACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks