EMAIL THIS PAGE TO A FRIEND

NRG2

neuregulin 2

Synonyms: DON1 HRG2 NTAK
UniProtKB ID: O14511
Gene ID:
Human(9542) Summary: This gene encodes a novel member of the neuregulin family of growth and differentiation factors. Through interaction with the ERBB family of receptors, this protein induces the growth and differentiation of epithelial, neuronal, glial, and other types of cells. The gene consists of 12 exons and the genomic structure is similar to that of neuregulin 1, another member of the neuregulin family of ligands. The products of these genes mediate distinct biological processes by acting at different sites in tissues and eliciting different biological responses in cells. This gene is located close to the region for demyelinating Charcot-Marie-Tooth disease locus, but is not responsible for this disease. Alternative transcript variants encoding distinct isoforms have been described. [provided by RefSeq, May 2010]
Mouse(100042150) neuregulin 2
Rat(432361) neuregulin 2
chicken(427606) neuregulin 2
cow(783452) neuregulin 2
dog(487158) neuregulin 2
sheep(101121348) neuregulin 2
154 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004883 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU163301 MISSION® esiRNA esiRNA targeting mouse Nrg2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004883 Rosetta Predictions human pricing
NM_013981 Rosetta Predictions human pricing
NM_013982 Rosetta Predictions human pricing
NM_013983 Rosetta Predictions human pricing
XM_001053475 Rosetta Predictions rat pricing
XM_001063076 Rosetta Predictions rat pricing
XM_344662 Rosetta Predictions rat pricing
XM_001478011 Rosetta Predictions mouse pricing
XM_001478024 Rosetta Predictions mouse pricing
XM_001478031 Rosetta Predictions mouse pricing
XM_001478044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121366 predicted 822
2 SASI_Hs01_00121367 predicted 786
3 SASI_Hs01_00121368 predicted 892
4 SASI_Hs01_00121369 predicted 1792
5 SASI_Hs01_00121370 predicted 767
6 SASI_Hs02_00338514 predicted 1059
7 SASI_Hs01_00121371 predicted 1103
8 SASI_Hs01_00121372 predicted 1847
9 SASI_Hs01_00121374 predicted 964
10 SASI_Hs01_00121375 predicted 1086
11 SASI_Hs01_00121373 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045439 predicted 824
2 SASI_Hs01_00045440 predicted 790
3 SASI_Hs01_00045441 predicted 893
4 SASI_Hs01_00045442 predicted 1780
5 SASI_Hs01_00045443 predicted 767
6 SASI_Hs02_00344939 predicted 1066
7 SASI_Hs01_00045444 predicted 1105
8 SASI_Hs01_00045445 predicted 1826
9 SASI_Hs01_00045447 predicted 964
10 SASI_Hs01_00045448 predicted 1086
11 SASI_Hs01_00045446 predicted 1665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099156 predicted 825
2 SASI_Hs01_00099157 predicted 792
3 SASI_Hs01_00099158 predicted 900
4 SASI_Hs01_00099159 predicted 1822
5 SASI_Hs01_00099160 predicted 769
6 SASI_Hs02_00344940 predicted 1062
7 SASI_Hs01_00099161 predicted 1103
8 SASI_Hs01_00099162 predicted 1870
9 SASI_Hs01_00099164 predicted 972
10 SASI_Hs01_00099165 predicted 1091
11 SASI_Hs01_00099163 predicted 1714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241861 predicted 825
2 SASI_Hs01_00241862 predicted 786
3 SASI_Hs01_00241863 predicted 892
4 SASI_Hs01_00241864 predicted 1805
5 SASI_Hs01_00241865 predicted 768
6 SASI_Hs02_00344941 predicted 1058
7 SASI_Hs01_00241866 predicted 1106
8 SASI_Hs01_00241867 predicted 1852
9 SASI_Hs01_00241869 predicted 971
10 SASI_Hs01_00241870 predicted 1092
11 SASI_Hs01_00241868 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272467 predicted 886
2 SASI_Rn02_00272468 predicted 1349
3 SASI_Rn02_00272469 predicted 1446
4 SASI_Rn02_00272470 predicted 931
5 SASI_Rn02_00272471 predicted 1640
6 SASI_Rn02_00272472 predicted 613
7 SASI_Rn02_00272473 predicted 1082
8 SASI_Rn02_00272474 predicted 1148
9 SASI_Rn02_00272475 predicted 1253
10 SASI_Rn02_00272476 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305688 predicted 884
2 SASI_Rn02_00305689 predicted 1213
3 SASI_Rn02_00305690 predicted 1458
4 SASI_Rn02_00305691 predicted 1854
5 SASI_Rn02_00305692 predicted 927
6 SASI_Rn02_00305693 predicted 1650
7 SASI_Rn02_00305694 predicted 610
8 SASI_Rn02_00305695 predicted 1085
9 SASI_Rn02_00305696 predicted 1152
10 SASI_Rn02_00305697 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397417 predicted 2450
2 SASI_Rn02_00397418 predicted 2455
3 SASI_Rn02_00397419 predicted 881
4 SASI_Rn02_00397420 predicted 2063
5 SASI_Rn02_00397421 predicted 1475
6 SASI_Rn02_00397422 predicted 1866
7 SASI_Rn02_00397423 predicted 928
8 SASI_Rn02_00397424 predicted 1669
9 SASI_Rn02_00397425 predicted 1209
10 SASI_Rn02_00397426 predicted 2800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399702 predicted 2032
2 SASI_Mm02_00399703 predicted 1634
3 SASI_Mm02_00399704 predicted 1136
4 SASI_Mm02_00399705 predicted 1440
5 SASI_Mm02_00399706 predicted 1106
6 SASI_Mm02_00399707 predicted 779
7 SASI_Mm02_00399708 predicted 1051
8 SASI_Mm02_00399709 predicted 1757
9 SASI_Mm02_00399710 predicted 829
10 SASI_Mm02_00399711 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399808 predicted 1130
2 SASI_Mm02_00399809 predicted 1102
3 SASI_Mm02_00399810 predicted 777
4 SASI_Mm02_00399811 predicted 702
5 SASI_Mm02_00399812 predicted 1905
6 SASI_Mm02_00399813 predicted 1176
7 SASI_Mm02_00399814 predicted 1655
8 SASI_Mm02_00399815 predicted 2325
9 SASI_Mm02_00399816 predicted 879
10 SASI_Mm02_00399817 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399866 predicted 1139
2 SASI_Mm02_00399867 predicted 1107
3 SASI_Mm02_00399868 predicted 777
4 SASI_Mm02_00399869 predicted 706
5 SASI_Mm02_00399870 predicted 1879
6 SASI_Mm02_00399871 predicted 1178
7 SASI_Mm02_00399872 predicted 1141
8 SASI_Mm02_00399873 predicted 1636
9 SASI_Mm02_00399874 predicted 1169
10 SASI_Mm02_00399875 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399948 predicted 1734
2 SASI_Mm02_00399949 predicted 1752
3 SASI_Mm02_00399950 predicted 1761
4 SASI_Mm02_00399951 predicted 1767
5 SASI_Mm02_00399952 predicted 1764
6 SASI_Mm02_00399953 predicted 1815
7 SASI_Mm02_00399954 predicted 1681
8 SASI_Mm02_00399955 predicted 1675
9 SASI_Mm02_00399956 predicted 1755
10 SASI_Mm02_00399957 predicted 1754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004883
NRG2 MISSION shRNA Bacterial Glycerol Stock
neuregulin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-1064s1c1
Sequence:CCGGGCCGAGACATTCGCATCAAATCTCGAGATTTGATGCGAATGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-1356s1c1
Sequence:CCGGCGGACAGAGATGTTTGGAGAACTCGAGTTCTCCAAACATCTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-1270s1c1
Sequence:CCGGGCCAAGTCCTATTGCGTCAATCTCGAGATTGACGCAATAGGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-933s1c1
Sequence:CCGGGCCCAAGTTGAAGAAGATGAACTCGAGTTCATCTTCTTCAACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-2239s1c1
Sequence:CCGGCGCAGCTATGACAGCTACTATCTCGAGATAGTAGCTGTCATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-788s21c1
Sequence:CCGGTCGAAAGGAACCAGCGCTACACTCGAGTGTAGCGCTGGTTCCTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-972s21c1
Sequence:CCGGGGGTGAGAAGCAATCGCTGAACTCGAGTTCAGCGATTGCTTCTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-839s21c1
Sequence:CCGGTAGTCTTTAAGACGGCCTTTGCTCGAGCAAAGGCCGTCTTAAAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-1095s21c1
Sequence:CCGGCAGAAAGAACTCACGACTACACTCGAGTGTAGTCGTGAGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-2067s21c1
Sequence:CCGGGGTGCCAACTTTCGAGATCACCTCGAGGTGATCTCGAAAGTTGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004883
NRG2 MISSION shRNA shRNA Plasmid DNA
neuregulin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-1064s1c1
Sequence:CCGGGCCGAGACATTCGCATCAAATCTCGAGATTTGATGCGAATGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-1356s1c1
Sequence:CCGGCGGACAGAGATGTTTGGAGAACTCGAGTTCTCCAAACATCTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-1270s1c1
Sequence:CCGGGCCAAGTCCTATTGCGTCAATCTCGAGATTGACGCAATAGGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-933s1c1
Sequence:CCGGGCCCAAGTTGAAGAAGATGAACTCGAGTTCATCTTCTTCAACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-2239s1c1
Sequence:CCGGCGCAGCTATGACAGCTACTATCTCGAGATAGTAGCTGTCATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-788s21c1
Sequence:CCGGTCGAAAGGAACCAGCGCTACACTCGAGTGTAGCGCTGGTTCCTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-972s21c1
Sequence:CCGGGGGTGAGAAGCAATCGCTGAACTCGAGTTCAGCGATTGCTTCTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-839s21c1
Sequence:CCGGTAGTCTTTAAGACGGCCTTTGCTCGAGCAAAGGCCGTCTTAAAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-1095s21c1
Sequence:CCGGCAGAAAGAACTCACGACTACACTCGAGTGTAGTCGTGAGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-2067s21c1
Sequence:CCGGGGTGCCAACTTTCGAGATCACCTCGAGGTGATCTCGAAAGTTGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004883
NRG2 MISSION shRNA Lentiviral Transduction Particles
neuregulin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-1064s1c1
Sequence:CCGGGCCGAGACATTCGCATCAAATCTCGAGATTTGATGCGAATGTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-1356s1c1
Sequence:CCGGCGGACAGAGATGTTTGGAGAACTCGAGTTCTCCAAACATCTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-1270s1c1
Sequence:CCGGGCCAAGTCCTATTGCGTCAATCTCGAGATTGACGCAATAGGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-933s1c1
Sequence:CCGGGCCCAAGTTGAAGAAGATGAACTCGAGTTCATCTTCTTCAACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004883.1-2239s1c1
Sequence:CCGGCGCAGCTATGACAGCTACTATCTCGAGATAGTAGCTGTCATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-788s21c1
Sequence:CCGGTCGAAAGGAACCAGCGCTACACTCGAGTGTAGCGCTGGTTCCTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-972s21c1
Sequence:CCGGGGGTGAGAAGCAATCGCTGAACTCGAGTTCAGCGATTGCTTCTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-839s21c1
Sequence:CCGGTAGTCTTTAAGACGGCCTTTGCTCGAGCAAAGGCCGTCTTAAAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-1095s21c1
Sequence:CCGGCAGAAAGAACTCACGACTACACTCGAGTGTAGTCGTGAGTTCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004883.1-2067s21c1
Sequence:CCGGGGTGCCAACTTTCGAGATCACCTCGAGGTGATCTCGAAAGTTGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks