EMAIL THIS PAGE TO A FRIEND

NSFL1C

NSFL1 (p97) cofactor (p47)

Synonyms: P47 UBX1 UBXD10 UBXN2C dJ776F14.1
Gene ID:
Human(55968) Summary: N-ethylmaleimide-sensitive factor (NSF) and valosin-containing protein (p97) are two ATPases known to be involved in transport vesicle/target membrane fusion and fusions between membrane compartments. A trimer of the protein encoded by this gene binds a hexamer of cytosolic p97 and is required for p97-mediated regrowth of Golgi cisternae from mitotic Golgi fragments. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, May 2011]
Mouse(386649) NSFL1 (p97) cofactor (p47)
Rat(83809) NSFL1 (p97) cofactor (p47)
Zebrafish(492805) NSFL1 (p97) cofactor (p47)
dog(100685961) NSFL1 (p97) cofactor (p47)
domestic cat(101100120) NSFL1 (p97) cofactor (p47)
cow(526612) NSFL1 (p97) cofactor (p47)
chicken(419268) NSFL1 (p97) cofactor (p47)
domestic guinea pig(100716759) NSFL1 (p97) cofactor (p47)
naked mole-rat(101704155) NSFL1 (p97) cofactor (p47)
Domestic Rabbit(100340741) NSFL1 (p97) cofactor (p47)
sheep(101120101) NSFL1 (p97) cofactor (p47)
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018839 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132971 MISSION® esiRNA esiRNA human NSFL1C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016143 Rosetta Predictions human pricing
NM_018839 Rosetta Predictions human pricing
NM_182483 Rosetta Predictions human pricing
NM_031981 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093959 predicted 1985
2 SASI_Hs01_00093960 predicted 2515
3 SASI_Hs01_00093961 predicted 1957
4 SASI_Hs01_00093962 predicted 1964
5 SASI_Hs01_00093963 predicted 2523
6 SASI_Hs01_00093964 predicted 1817
7 SASI_Hs01_00093965 predicted 1814
8 SASI_Hs01_00093968 predicted 2032
9 SASI_Hs02_00348937 predicted 1139
10 SASI_Hs02_00348938 predicted 1552
11 SASI_Hs01_00093966 predicted 1842
12 SASI_Hs01_00093967 predicted 1322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099541 predicted 1897
2 SASI_Hs01_00099542 predicted 2428
3 SASI_Hs01_00099543 predicted 1862
4 SASI_Hs01_00099544 predicted 1868
5 SASI_Hs01_00099545 predicted 2427
6 SASI_Hs01_00099546 predicted 1721
7 SASI_Hs01_00099547 predicted 1722
8 SASI_Hs01_00099549 predicted 1941
9 SASI_Hs01_00099550 predicted 1371
10 SASI_Hs02_00352291 predicted 1148
11 SASI_Hs01_00099548 predicted 1741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104888 predicted 1793
2 SASI_Hs01_00104889 predicted 2327
3 SASI_Hs01_00104890 predicted 1767
4 SASI_Hs01_00104891 predicted 1770
5 SASI_Hs01_00104892 predicted 2324
6 SASI_Hs01_00104893 predicted 1622
7 SASI_Hs01_00104894 predicted 1618
8 SASI_Hs01_00104896 predicted 2236
9 SASI_Hs01_00104897 predicted 1840
10 SASI_Hs02_00370516 predicted 2145
11 SASI_Hs01_00104895 predicted 1649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077880 predicted 620
2 SASI_Rn01_00077881 predicted 719
3 SASI_Rn01_00077882 predicted 320
4 SASI_Rn01_00077884 predicted 498
5 SASI_Rn01_00077885 predicted 450
6 SASI_Rn01_00077886 predicted 301
7 SASI_Rn01_00077887 predicted 1120
8 SASI_Rn02_00265378 predicted 1121
9 SASI_Rn01_00077889 predicted 327
10 SASI_Rn02_00265379 predicted 1194
11 SASI_Rn01_00077883 predicted 410
12 SASI_Rn01_00077888 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018839
VALIDATED
NSFL1C MISSION shRNA Bacterial Glycerol Stock
NSFL1 (p97) cofactor (p47)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018839.3-1576s1c1
Sequence:CCGGGAGGACTTTGTGAAGCCCAAACTCGAGTTTGGGCTTCACAAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018839.3-1299s1c1
Sequence:CCGGGCTGGTGGATGATCTCTTTAACTCGAGTTAAAGAGATCATCCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018839.3-1419s1c1
Sequence:CCGGGAGTGGATTCAGCCTGGATAACTCGAGTTATCCAGGCTGAATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018839.3-3099s1c1
Sequence:CCGGCCCTATAAGTTTGATTGCTATCTCGAGATAGCAATCAAACTTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018839.3-1148s1c1
Sequence:CCGGCCAGTGATAATAGAGTGACATCTCGAGATGTCACTCTATTATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_018839.3-1948s21c1
Sequence:CCGGATCGTGCAGCGGTTAACATAACTCGAGTTATGTTAACCGCTGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018839.3-1576s21c1
Sequence:CCGGGAGGACTTTGTGAAGCCCAAACTCGAGTTTGGGCTTCACAAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018839.3-1419s21c1
Sequence:CCGGGAGTGGATTCAGCCTGGATAACTCGAGTTATCCAGGCTGAATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018839.3-2431s21c1
Sequence:CCGGCCACTTGTTCCCACGAGAATACTCGAGTATTCTCGTGGGAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018839.3-1387s21c1
Sequence:CCGGCCGAGAGTTCATGTAGTATTGCTCGAGCAATACTACATGAACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018839
VALIDATED
NSFL1C MISSION shRNA shRNA Plasmid DNA
NSFL1 (p97) cofactor (p47)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018839.3-1576s1c1
Sequence:CCGGGAGGACTTTGTGAAGCCCAAACTCGAGTTTGGGCTTCACAAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018839.3-1299s1c1
Sequence:CCGGGCTGGTGGATGATCTCTTTAACTCGAGTTAAAGAGATCATCCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018839.3-1419s1c1
Sequence:CCGGGAGTGGATTCAGCCTGGATAACTCGAGTTATCCAGGCTGAATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018839.3-3099s1c1
Sequence:CCGGCCCTATAAGTTTGATTGCTATCTCGAGATAGCAATCAAACTTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018839.3-1148s1c1
Sequence:CCGGCCAGTGATAATAGAGTGACATCTCGAGATGTCACTCTATTATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_018839.3-1948s21c1
Sequence:CCGGATCGTGCAGCGGTTAACATAACTCGAGTTATGTTAACCGCTGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018839.3-1576s21c1
Sequence:CCGGGAGGACTTTGTGAAGCCCAAACTCGAGTTTGGGCTTCACAAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018839.3-1419s21c1
Sequence:CCGGGAGTGGATTCAGCCTGGATAACTCGAGTTATCCAGGCTGAATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018839.3-2431s21c1
Sequence:CCGGCCACTTGTTCCCACGAGAATACTCGAGTATTCTCGTGGGAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018839.3-1387s21c1
Sequence:CCGGCCGAGAGTTCATGTAGTATTGCTCGAGCAATACTACATGAACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018839
VALIDATED
NSFL1C MISSION shRNA Lentiviral Transduction Particles
NSFL1 (p97) cofactor (p47)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018839.3-1576s1c1
Sequence:CCGGGAGGACTTTGTGAAGCCCAAACTCGAGTTTGGGCTTCACAAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018839.3-1299s1c1
Sequence:CCGGGCTGGTGGATGATCTCTTTAACTCGAGTTAAAGAGATCATCCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018839.3-1419s1c1
Sequence:CCGGGAGTGGATTCAGCCTGGATAACTCGAGTTATCCAGGCTGAATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160212    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018839.3-3099s1c1
Sequence:CCGGCCCTATAAGTTTGATTGCTATCTCGAGATAGCAATCAAACTTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018839.3-1148s1c1
Sequence:CCGGCCAGTGATAATAGAGTGACATCTCGAGATGTCACTCTATTATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_018839.3-1948s21c1
Sequence:CCGGATCGTGCAGCGGTTAACATAACTCGAGTTATGTTAACCGCTGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018839.3-1576s21c1
Sequence:CCGGGAGGACTTTGTGAAGCCCAAACTCGAGTTTGGGCTTCACAAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018839.3-1419s21c1
Sequence:CCGGGAGTGGATTCAGCCTGGATAACTCGAGTTATCCAGGCTGAATCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018839.3-2431s21c1
Sequence:CCGGCCACTTGTTCCCACGAGAATACTCGAGTATTCTCGTGGGAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018839.3-1387s21c1
Sequence:CCGGCCGAGAGTTCATGTAGTATTGCTCGAGCAATACTACATGAACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198326
VALIDATED
NSFL1C MISSION shRNA Bacterial Glycerol Stock
NSFL1 (p97) cofactor (p47)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-550s1c1
Sequence:CCGGGTAGTGCTAAAGCTCTGGAAACTCGAGTTTCCAGAGCTTTAGCACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-604s1c1
Sequence:CCGGAGCTACCAAGACCCATCCAATCTCGAGATTGGATGGGTCTTGGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-487s1c1
Sequence:CCGGCCAGAGGAAGAGTCTGCCTATCTCGAGATAGGCAGACTCTTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-706s1c1
Sequence:CCGGGATATGGAGGATCATCGGGATCTCGAGATCCCGATGATCCTCCATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198326.1-800s1c1
Sequence:CCGGCCCAGGTATTAAACACCAGCTCTCGAGAGCTGGTGTTTAATACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-487s21c1
Sequence:CCGGCCAGAGGAAGAGTCTGCCTATCTCGAGATAGGCAGACTCTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-800s21c1
Sequence:CCGGCCCAGGTATTAAACACCAGCTCTCGAGAGCTGGTGTTTAATACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-706s21c1
Sequence:CCGGGATATGGAGGATCATCGGGATCTCGAGATCCCGATGATCCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-604s21c1
Sequence:CCGGAGCTACCAAGACCCATCCAATCTCGAGATTGGATGGGTCTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-550s21c1
Sequence:CCGGGTAGTGCTAAAGCTCTGGAAACTCGAGTTTCCAGAGCTTTAGCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198326
VALIDATED
NSFL1C MISSION shRNA shRNA Plasmid DNA
NSFL1 (p97) cofactor (p47)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-550s1c1
Sequence:CCGGGTAGTGCTAAAGCTCTGGAAACTCGAGTTTCCAGAGCTTTAGCACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-604s1c1
Sequence:CCGGAGCTACCAAGACCCATCCAATCTCGAGATTGGATGGGTCTTGGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-487s1c1
Sequence:CCGGCCAGAGGAAGAGTCTGCCTATCTCGAGATAGGCAGACTCTTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-706s1c1
Sequence:CCGGGATATGGAGGATCATCGGGATCTCGAGATCCCGATGATCCTCCATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198326.1-800s1c1
Sequence:CCGGCCCAGGTATTAAACACCAGCTCTCGAGAGCTGGTGTTTAATACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-487s21c1
Sequence:CCGGCCAGAGGAAGAGTCTGCCTATCTCGAGATAGGCAGACTCTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-800s21c1
Sequence:CCGGCCCAGGTATTAAACACCAGCTCTCGAGAGCTGGTGTTTAATACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-706s21c1
Sequence:CCGGGATATGGAGGATCATCGGGATCTCGAGATCCCGATGATCCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-604s21c1
Sequence:CCGGAGCTACCAAGACCCATCCAATCTCGAGATTGGATGGGTCTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-550s21c1
Sequence:CCGGGTAGTGCTAAAGCTCTGGAAACTCGAGTTTCCAGAGCTTTAGCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198326
VALIDATED
NSFL1C MISSION shRNA Lentiviral Transduction Particles
NSFL1 (p97) cofactor (p47)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-550s1c1
Sequence:CCGGGTAGTGCTAAAGCTCTGGAAACTCGAGTTTCCAGAGCTTTAGCACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-604s1c1
Sequence:CCGGAGCTACCAAGACCCATCCAATCTCGAGATTGGATGGGTCTTGGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-487s1c1
Sequence:CCGGCCAGAGGAAGAGTCTGCCTATCTCGAGATAGGCAGACTCTTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198326.1-706s1c1
Sequence:CCGGGATATGGAGGATCATCGGGATCTCGAGATCCCGATGATCCTCCATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198326.1-800s1c1
Sequence:CCGGCCCAGGTATTAAACACCAGCTCTCGAGAGCTGGTGTTTAATACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-487s21c1
Sequence:CCGGCCAGAGGAAGAGTCTGCCTATCTCGAGATAGGCAGACTCTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-800s21c1
Sequence:CCGGCCCAGGTATTAAACACCAGCTCTCGAGAGCTGGTGTTTAATACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-706s21c1
Sequence:CCGGGATATGGAGGATCATCGGGATCTCGAGATCCCGATGATCCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-604s21c1
Sequence:CCGGAGCTACCAAGACCCATCCAATCTCGAGATTGGATGGGTCTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198326.2-550s21c1
Sequence:CCGGGTAGTGCTAAAGCTCTGGAAACTCGAGTTTCCAGAGCTTTAGCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks