EMAIL THIS PAGE TO A FRIEND

NSUN3

NOP2/Sun domain family, member 3

Synonyms: MST077
UniProtKB ID: Q9H649, Q6PG41, Q8IXG9, Q9H6M2
Gene ID:
Mouse(106338) NOL1/NOP2/Sun domain family member 3
Rat(100360437) NOP2/Sun domain family, member 3
Zebrafish(553534) NOP2/Sun domain family, member 3
cow(533791) NOP2/Sun domain family, member 3
domestic cat(101081569) NOP2/Sun domain family, member 3
dog(607320) NOP2/Sun domain family, member 3
chicken(418432) NOP2/Sun domain family, member 3
Domestic Rabbit(100343486) NOP2/Sun domain family, member 3
naked mole-rat(101724598) NOP2/Sun domain family, member 3
sheep(101102108) NOP2/Sun domain family, member 3
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022072 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022072 Rosetta Predictions human pricing
NM_178925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247321 predicted 608
2 SASI_Hs01_00247322 predicted 380
3 SASI_Hs01_00247323 predicted 422
4 SASI_Hs01_00247325 predicted 235
5 SASI_Hs01_00247326 predicted 980
6 SASI_Hs01_00247327 predicted 314
7 SASI_Hs02_00355438 predicted 225
8 SASI_Hs01_00247328 predicted 816
9 SASI_Hs01_00247329 predicted 1044
10 SASI_Hs01_00247330 predicted 828
11 SASI_Hs01_00247324 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198488 predicted 494
2 SASI_Mm01_00198489 predicted 887
3 SASI_Mm01_00198490 predicted 861
4 SASI_Mm01_00198491 predicted 855
5 SASI_Mm01_00198492 predicted 849
6 SASI_Mm01_00198493 predicted 273
7 SASI_Mm02_00349556 predicted 919
8 SASI_Mm01_00198494 predicted 290
9 SASI_Mm01_00198495 predicted 718
10 SASI_Mm01_00198496 predicted 475
11 SASI_Mm01_00198497 predicted 621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178925
NSUN3 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178925.2-2378s1c1
Sequence:CCGGCGGCAATAACTGAACTATATTCTCGAGAATATAGTTCAGTTATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-248s1c1
Sequence:CCGGCGATTCAATTATCCCTTTGAACTCGAGTTCAAAGGGATAATTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-683s1c1
Sequence:CCGGGCAACATTTGACAAGGTGTTACTCGAGTAACACCTTGTCAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-235s1c1
Sequence:CCGGCATCCTCTTCAACCGATTCAACTCGAGTTGAATCGGTTGAAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-938s1c1
Sequence:CCGGCCTGTGGATATTAGTGGGATACTCGAGTATCCCACTAATATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178925
NSUN3 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178925.2-2378s1c1
Sequence:CCGGCGGCAATAACTGAACTATATTCTCGAGAATATAGTTCAGTTATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-248s1c1
Sequence:CCGGCGATTCAATTATCCCTTTGAACTCGAGTTCAAAGGGATAATTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-683s1c1
Sequence:CCGGGCAACATTTGACAAGGTGTTACTCGAGTAACACCTTGTCAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-235s1c1
Sequence:CCGGCATCCTCTTCAACCGATTCAACTCGAGTTGAATCGGTTGAAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-938s1c1
Sequence:CCGGCCTGTGGATATTAGTGGGATACTCGAGTATCCCACTAATATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178925
NSUN3 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178925.2-2378s1c1
Sequence:CCGGCGGCAATAACTGAACTATATTCTCGAGAATATAGTTCAGTTATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-248s1c1
Sequence:CCGGCGATTCAATTATCCCTTTGAACTCGAGTTCAAAGGGATAATTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-683s1c1
Sequence:CCGGGCAACATTTGACAAGGTGTTACTCGAGTAACACCTTGTCAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-235s1c1
Sequence:CCGGCATCCTCTTCAACCGATTCAACTCGAGTTGAATCGGTTGAAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178925.2-938s1c1
Sequence:CCGGCCTGTGGATATTAGTGGGATACTCGAGTATCCCACTAATATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022072
VALIDATED
NSUN3 MISSION shRNA Bacterial Glycerol Stock
NOP2/Sun domain family, member 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022072.2-962s1c1
Sequence:CCGGCCACGGTAACATCATGCCTATCTCGAGATAGGCATGATGTTACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022072.2-716s1c1
Sequence:CCGGCCAGCCTGAAATGTTTGACAACTCGAGTTGTCAAACATTTCAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022072.2-801s1c1
Sequence:CCGGGCATCCTGTAGGATAAGTCAACTCGAGTTGACTTATCCTACAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022072.2-754s1c1
Sequence:CCGGCGTGTTCAAATGATCGAAGCTCTCGAGAGCTTCGATCATTTGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022072.2-1087s1c1
Sequence:CCGGGCCCAATGTATGTAGCCAAATCTCGAGATTTGGCTACATACATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022072.2-1286s1c1
Sequence:CCGGCTTGAGAATTGTTCAGGTGTACTCGAGTACACCTGAACAATTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022072.2-654s1c1
Sequence:CCGGCCACAGCCTTTGATAAATGTACTCGAGTACATTTATCAAAGGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022072.2-851s1c1
Sequence:CCGGGCTGTTAAGGTCTGCAATTAACTCGAGTTAATTGCAGACCTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022072.2-1273s1c1
Sequence:CCGGCTTAGAATCTAGGCTTGAGAACTCGAGTTCTCAAGCCTAGATTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022072.3-170s21c1
Sequence:CCGGCAAAGTTGTGTTGGATCATTTCTCGAGAAATGATCCAACACAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022072.3-342s21c1
Sequence:CCGGACACTCTCTCAGGGATCTTTACTCGAGTAAAGATCCCTGAGAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022072.3-277s21c1
Sequence:CCGGTCCTGCTTAACCGATTCAATTCTCGAGAATTGAATCGGTTAAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_022072.3-485s21c1
Sequence:CCGGAGTGTTGGCTCTGGAATTAAGCTCGAGCTTAATTCCAGAGCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_022072.3-1235s21c1
Sequence:CCGGGGTCTGTTTGGAATCCTATTTCTCGAGAAATAGGATTCCAAACAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022072
VALIDATED
NSUN3 MISSION shRNA shRNA Plasmid DNA
NOP2/Sun domain family, member 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022072.2-962s1c1
Sequence:CCGGCCACGGTAACATCATGCCTATCTCGAGATAGGCATGATGTTACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022072.2-716s1c1
Sequence:CCGGCCAGCCTGAAATGTTTGACAACTCGAGTTGTCAAACATTTCAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022072.2-801s1c1
Sequence:CCGGGCATCCTGTAGGATAAGTCAACTCGAGTTGACTTATCCTACAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022072.2-754s1c1
Sequence:CCGGCGTGTTCAAATGATCGAAGCTCTCGAGAGCTTCGATCATTTGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022072.2-1087s1c1
Sequence:CCGGGCCCAATGTATGTAGCCAAATCTCGAGATTTGGCTACATACATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022072.2-1286s1c1
Sequence:CCGGCTTGAGAATTGTTCAGGTGTACTCGAGTACACCTGAACAATTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022072.2-654s1c1
Sequence:CCGGCCACAGCCTTTGATAAATGTACTCGAGTACATTTATCAAAGGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022072.2-851s1c1
Sequence:CCGGGCTGTTAAGGTCTGCAATTAACTCGAGTTAATTGCAGACCTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022072.2-1273s1c1
Sequence:CCGGCTTAGAATCTAGGCTTGAGAACTCGAGTTCTCAAGCCTAGATTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022072.3-170s21c1
Sequence:CCGGCAAAGTTGTGTTGGATCATTTCTCGAGAAATGATCCAACACAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022072.3-342s21c1
Sequence:CCGGACACTCTCTCAGGGATCTTTACTCGAGTAAAGATCCCTGAGAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022072.3-277s21c1
Sequence:CCGGTCCTGCTTAACCGATTCAATTCTCGAGAATTGAATCGGTTAAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_022072.3-485s21c1
Sequence:CCGGAGTGTTGGCTCTGGAATTAAGCTCGAGCTTAATTCCAGAGCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_022072.3-1235s21c1
Sequence:CCGGGGTCTGTTTGGAATCCTATTTCTCGAGAAATAGGATTCCAAACAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022072
VALIDATED
NSUN3 MISSION shRNA Lentiviral Transduction Particles
NOP2/Sun domain family, member 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022072.2-962s1c1
Sequence:CCGGCCACGGTAACATCATGCCTATCTCGAGATAGGCATGATGTTACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022072.2-716s1c1
Sequence:CCGGCCAGCCTGAAATGTTTGACAACTCGAGTTGTCAAACATTTCAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022072.2-801s1c1
Sequence:CCGGGCATCCTGTAGGATAAGTCAACTCGAGTTGACTTATCCTACAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022072.2-754s1c1
Sequence:CCGGCGTGTTCAAATGATCGAAGCTCTCGAGAGCTTCGATCATTTGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022072.2-1087s1c1
Sequence:CCGGGCCCAATGTATGTAGCCAAATCTCGAGATTTGGCTACATACATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022072.2-1286s1c1
Sequence:CCGGCTTGAGAATTGTTCAGGTGTACTCGAGTACACCTGAACAATTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150339    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022072.2-654s1c1
Sequence:CCGGCCACAGCCTTTGATAAATGTACTCGAGTACATTTATCAAAGGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022072.2-851s1c1
Sequence:CCGGGCTGTTAAGGTCTGCAATTAACTCGAGTTAATTGCAGACCTTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022072.2-1273s1c1
Sequence:CCGGCTTAGAATCTAGGCTTGAGAACTCGAGTTCTCAAGCCTAGATTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_022072.3-170s21c1
Sequence:CCGGCAAAGTTGTGTTGGATCATTTCTCGAGAAATGATCCAACACAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022072.3-342s21c1
Sequence:CCGGACACTCTCTCAGGGATCTTTACTCGAGTAAAGATCCCTGAGAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022072.3-277s21c1
Sequence:CCGGTCCTGCTTAACCGATTCAATTCTCGAGAATTGAATCGGTTAAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_022072.3-485s21c1
Sequence:CCGGAGTGTTGGCTCTGGAATTAAGCTCGAGCTTAATTCCAGAGCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_022072.3-1235s21c1
Sequence:CCGGGGTCTGTTTGGAATCCTATTTCTCGAGAAATAGGATTCCAAACAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks