EMAIL THIS PAGE TO A FRIEND

NT5C3B

5'-nucleotidase, cytosolic IIIB

Synonyms: NT5C3L
UniProtKB ID: Q969T7, A8MWB9, C9JKC4, Q7L3B7
Gene ID:
Mouse(68106) 5'-nucleotidase, cytosolic IIIB
Rat(360629) 5'-nucleotidase, cytosolic IIIB
domestic guinea pig(100715400) 5'-nucleotidase, cytosolic IIIB
naked mole-rat(101725218) 5'-nucleotidase, cytosolic IIIB
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052935 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052935 Rosetta Predictions human pricing
NM_001007723 Rosetta Predictions rat pricing
XM_001081457 Rosetta Predictions rat pricing
NM_001102650 Rosetta Predictions mouse pricing
NM_026561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361716 predicted 761
2 SASI_Hs01_00054962 predicted 441
3 SASI_Hs01_00054963 predicted 807
4 SASI_Hs02_00361717 predicted 842
5 SASI_Hs02_00361718 predicted 855
6 SASI_Hs01_00054965 predicted 641
7 SASI_Hs01_00054966 predicted 406
8 SASI_Hs01_00054967 predicted 369
9 SASI_Hs01_00054968 predicted 439
10 SASI_Hs01_00054969 predicted 448
11 SASI_Hs01_00054964 predicted 709
12 SASI_Hs01_00054970 predicted 562
13 SASI_Hs01_00054971 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198906 predicted 1427
2 SASI_Rn01_00046446 predicted 875
3 SASI_Rn01_00046447 predicted 732
4 SASI_Rn01_00046448 predicted 849
5 SASI_Rn01_00046449 predicted 1123
6 SASI_Rn01_00046452 predicted 861
7 SASI_Rn02_00198907 predicted 460
8 SASI_Rn02_00198908 predicted 446
9 SASI_Rn01_00046454 predicted 761
10 SASI_Rn02_00198909 predicted 1044
11 SASI_Rn01_00046450 predicted 716
12 SASI_Rn01_00046451 predicted 747
13 SASI_Rn01_00046453 predicted 894
14 SASI_Rn01_00046455 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371976 predicted 1395
2 SASI_Rn02_00371977 predicted 1349
3 SASI_Rn02_00371978 predicted 1367
4 SASI_Rn02_00371979 predicted 1044
5 SASI_Rn02_00371980 predicted 386
6 SASI_Rn02_00371981 predicted 373
7 SASI_Rn02_00371982 predicted 1233
8 SASI_Rn02_00371983 predicted 1348
9 SASI_Rn02_00371984 predicted 973
10 SASI_Rn02_00371985 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303039 predicted 561
2 SASI_Mm02_00303040 predicted 503
3 SASI_Mm02_00303041 predicted 452
4 SASI_Mm02_00303042 predicted 503
5 SASI_Mm02_00303043 predicted 438
6 SASI_Mm02_00303044 predicted 193
7 SASI_Mm02_00303045 predicted 425
8 SASI_Mm02_00303046 predicted 200
9 SASI_Mm02_00303047 predicted 446
10 SASI_Mm02_00303048 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159459 predicted 559
2 SASI_Mm02_00330502 predicted 507
3 SASI_Mm02_00330503 predicted 460
4 SASI_Mm02_00330504 predicted 502
5 SASI_Mm01_00159462 predicted 434
6 SASI_Mm02_00330505 predicted 198
7 SASI_Mm01_00159463 predicted 428
8 SASI_Mm02_00330506 predicted 200
9 SASI_Mm01_00159465 predicted 445
10 SASI_Mm02_00330507 predicted 281
11 SASI_Mm01_00159457 predicted 660
12 SASI_Mm01_00159458 predicted 497
13 SASI_Mm01_00159460 predicted 853
14 SASI_Mm01_00159461 predicted 1183
15 SASI_Mm01_00159464 predicted 909
16 SASI_Mm01_00159466 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052935
VALIDATED
NT5C3B MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase, cytosolic IIIB
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052935.3-1321s21c1
Sequence:CCGGCTTCATCACCAGAGGCTTGAACTCGAGTTCAAGCCTCTGGTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052935.3-1369s21c1
Sequence:CCGGGCACTGTTCCTGGTGAACCTTCTCGAGAAGGTTCACCAGGAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052935.3-504s21c1
Sequence:CCGGAGCGCTCCTTCACCACTATTACTCGAGTAATAGTGGTGAAGGAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_052935.2-821s1c1
Sequence:CCGGGCTGATACACACATACAACAACTCGAGTTGTTGTATGTGTGTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052935.2-330s1c1
Sequence:CCGGCGGTTACAGGTGATTTCTGATCTCGAGATCAGAAATCACCTGTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052935.2-510s1c1
Sequence:CCGGGTCAAGGAGAAGCTACCTCATCTCGAGATGAGGTAGCTTCTCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052935.2-389s1c1
Sequence:CCGGGCGATGCCCTTCTTCTTACAACTCGAGTTGTAAGAAGAAGGGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052935.2-359s1c1
Sequence:CCGGGACCTTGAGCAGGTTTGCATACTCGAGTATGCAAACCTGCTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052935.2-584s1c1
Sequence:CCGGGAAGTTTCAGATAGCCCAGGTCTCGAGACCTGGGCTATCTGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_052935.2-1028s1c1
Sequence:CCGGCTATGACATCGTGCTGGAGAACTCGAGTTCTCCAGCACGATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052935.2-557s1c1
Sequence:CCGGCAATCTCCTATGTCAGCAGAACTCGAGTTCTGCTGACATAGGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052935
VALIDATED
NT5C3B MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase, cytosolic IIIB
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052935.3-1321s21c1
Sequence:CCGGCTTCATCACCAGAGGCTTGAACTCGAGTTCAAGCCTCTGGTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052935.3-1369s21c1
Sequence:CCGGGCACTGTTCCTGGTGAACCTTCTCGAGAAGGTTCACCAGGAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052935.3-504s21c1
Sequence:CCGGAGCGCTCCTTCACCACTATTACTCGAGTAATAGTGGTGAAGGAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_052935.2-821s1c1
Sequence:CCGGGCTGATACACACATACAACAACTCGAGTTGTTGTATGTGTGTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052935.2-330s1c1
Sequence:CCGGCGGTTACAGGTGATTTCTGATCTCGAGATCAGAAATCACCTGTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052935.2-510s1c1
Sequence:CCGGGTCAAGGAGAAGCTACCTCATCTCGAGATGAGGTAGCTTCTCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052935.2-389s1c1
Sequence:CCGGGCGATGCCCTTCTTCTTACAACTCGAGTTGTAAGAAGAAGGGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052935.2-359s1c1
Sequence:CCGGGACCTTGAGCAGGTTTGCATACTCGAGTATGCAAACCTGCTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052935.2-584s1c1
Sequence:CCGGGAAGTTTCAGATAGCCCAGGTCTCGAGACCTGGGCTATCTGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_052935.2-1028s1c1
Sequence:CCGGCTATGACATCGTGCTGGAGAACTCGAGTTCTCCAGCACGATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052935.2-557s1c1
Sequence:CCGGCAATCTCCTATGTCAGCAGAACTCGAGTTCTGCTGACATAGGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052935
VALIDATED
NT5C3B MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase, cytosolic IIIB
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052935.3-1321s21c1
Sequence:CCGGCTTCATCACCAGAGGCTTGAACTCGAGTTCAAGCCTCTGGTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052935.3-1369s21c1
Sequence:CCGGGCACTGTTCCTGGTGAACCTTCTCGAGAAGGTTCACCAGGAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052935.3-504s21c1
Sequence:CCGGAGCGCTCCTTCACCACTATTACTCGAGTAATAGTGGTGAAGGAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_052935.2-821s1c1
Sequence:CCGGGCTGATACACACATACAACAACTCGAGTTGTTGTATGTGTGTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052935.2-330s1c1
Sequence:CCGGCGGTTACAGGTGATTTCTGATCTCGAGATCAGAAATCACCTGTAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052935.2-510s1c1
Sequence:CCGGGTCAAGGAGAAGCTACCTCATCTCGAGATGAGGTAGCTTCTCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052935.2-389s1c1
Sequence:CCGGGCGATGCCCTTCTTCTTACAACTCGAGTTGTAAGAAGAAGGGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052935.2-359s1c1
Sequence:CCGGGACCTTGAGCAGGTTTGCATACTCGAGTATGCAAACCTGCTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052935.2-584s1c1
Sequence:CCGGGAAGTTTCAGATAGCCCAGGTCTCGAGACCTGGGCTATCTGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_052935.2-1028s1c1
Sequence:CCGGCTATGACATCGTGCTGGAGAACTCGAGTTCTCCAGCACGATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052935.2-557s1c1
Sequence:CCGGCAATCTCCTATGTCAGCAGAACTCGAGTTCTGCTGACATAGGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026561
VALIDATED
NT5C3B MISSION shRNA Bacterial Glycerol Stock
5'-nucleotidase, cytosolic IIIB
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026561.4-869s21c1
Sequence:CCGGGCAAGCTCACCCACACCTAAACTCGAGTTTAGGTGTGGGTGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-200s21c1
Sequence:CCGGTGCCCTTCTTCCCACAATATTCTCGAGAATATTGTGGGAAGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-269s21c1
Sequence:CCGGGAGCTCTTTCACCACTATTATCTCGAGATAATAGTGGTGAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-139s21c1
Sequence:CCGGCCTGCAGGTGATTTCCGATTTCTCGAGAAATCGGAAATCACCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-430s21c1
Sequence:CCGGGATGCTCAGGGAGGGCTATAACTCGAGTTATAGCCCTCCCTGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026561.2-755s1c1
Sequence:CCGGGAACATTCTCAAGATCGGCTTCTCGAGAAGCCGATCTTGAGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026561.2-614s1c1
Sequence:CCGGGCTCATTCACACCTACAACAACTCGAGTTGTTGTAGGTGTGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026561
VALIDATED
NT5C3B MISSION shRNA shRNA Plasmid DNA
5'-nucleotidase, cytosolic IIIB
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026561.4-869s21c1
Sequence:CCGGGCAAGCTCACCCACACCTAAACTCGAGTTTAGGTGTGGGTGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-200s21c1
Sequence:CCGGTGCCCTTCTTCCCACAATATTCTCGAGAATATTGTGGGAAGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-269s21c1
Sequence:CCGGGAGCTCTTTCACCACTATTATCTCGAGATAATAGTGGTGAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-139s21c1
Sequence:CCGGCCTGCAGGTGATTTCCGATTTCTCGAGAAATCGGAAATCACCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-430s21c1
Sequence:CCGGGATGCTCAGGGAGGGCTATAACTCGAGTTATAGCCCTCCCTGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026561.2-755s1c1
Sequence:CCGGGAACATTCTCAAGATCGGCTTCTCGAGAAGCCGATCTTGAGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026561.2-614s1c1
Sequence:CCGGGCTCATTCACACCTACAACAACTCGAGTTGTTGTAGGTGTGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026561
VALIDATED
NT5C3B MISSION shRNA Lentiviral Transduction Particles
5'-nucleotidase, cytosolic IIIB
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026561.4-869s21c1
Sequence:CCGGGCAAGCTCACCCACACCTAAACTCGAGTTTAGGTGTGGGTGAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-200s21c1
Sequence:CCGGTGCCCTTCTTCCCACAATATTCTCGAGAATATTGTGGGAAGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-269s21c1
Sequence:CCGGGAGCTCTTTCACCACTATTATCTCGAGATAATAGTGGTGAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-139s21c1
Sequence:CCGGCCTGCAGGTGATTTCCGATTTCTCGAGAAATCGGAAATCACCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026561.4-430s21c1
Sequence:CCGGGATGCTCAGGGAGGGCTATAACTCGAGTTATAGCCCTCCCTGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026561.2-755s1c1
Sequence:CCGGGAACATTCTCAAGATCGGCTTCTCGAGAAGCCGATCTTGAGAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026561.2-614s1c1
Sequence:CCGGGCTCATTCACACCTACAACAACTCGAGTTGTTGTAGGTGTGAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks