EMAIL THIS PAGE TO A FRIEND

NTAN1

N-terminal asparagine amidase

Synonyms: PNAA PNAD
UniProtKB ID: Q96AB6
Gene ID:
Human(123803) Summary: The protein encoded by this gene functions in a step-wise process of protein degradation through the N-end rule pathway. This protein acts as a tertiary destabilizing enzyme that deamidates N-terminal L-Asn residues on proteins to produce N-terminal L-Asp. L-Asp substrates are subsequently conjugated to L-Arg, which is recognized by specific E3 ubiquitin ligases and targeted to the proteasome. Pseudogenes of this gene are located on the long arms of chromosomes 8, 10 and 12. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Mouse(18203) N-terminal Asn amidase
Rat(360462) N-terminal asparagine amidase
sheep(101113380) N-terminal asparagine amidase
naked mole-rat(101726114) N-terminal asparagine amidase
domestic guinea pig(100716021) N-terminal asparagine amidase
chicken(768445) N-terminal asparagine amidase
dog(609485) N-terminal asparagine amidase
cow(505869) N-terminal asparagine amidase
domestic cat(101080602) N-terminal asparagine amidase
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173474 Rosetta Predictions human pricing
NM_001025124 Rosetta Predictions rat pricing
NM_010946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118218 predicted 546
2 SASI_Hs01_00118219 predicted 239
3 SASI_Hs01_00118220 predicted 276
4 SASI_Hs01_00118221 predicted 563
5 SASI_Hs01_00118223 predicted 607
6 SASI_Hs02_00368229 predicted 462
7 SASI_Hs01_00118225 predicted 514
8 SASI_Hs01_00118227 predicted 442
9 SASI_Hs02_00368230 predicted 372
10 SASI_Hs02_00368231 predicted 556
11 SASI_Hs01_00118222 predicted 452
12 SASI_Hs01_00118224 predicted 642
13 SASI_Hs01_00118226 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105483 predicted 335
2 SASI_Rn02_00203034 predicted 658
3 SASI_Rn01_00105488 predicted 395
4 SASI_Rn02_00203035 predicted 436
5 SASI_Rn01_00105489 predicted 584
6 SASI_Rn02_00203036 predicted 471
7 SASI_Rn01_00105490 predicted 628
8 SASI_Rn01_00105491 predicted 298
9 SASI_Rn01_00105492 predicted 239
10 SASI_Rn02_00203037 predicted 404
11 SASI_Rn01_00105484 predicted 774
12 SASI_Rn01_00105485 predicted 667
13 SASI_Rn01_00105486 predicted 717
14 SASI_Rn01_00105487 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132840 predicted 542
2 SASI_Mm01_00132841 predicted 713
3 SASI_Mm01_00132842 predicted 341
4 SASI_Mm01_00132843 predicted 655
5 SASI_Mm01_00132844 predicted 677
6 SASI_Mm01_00132845 predicted 485
7 SASI_Mm01_00132846 predicted 385
8 SASI_Mm01_00132848 predicted 523
9 SASI_Mm01_00132849 predicted 309
10 SASI_Mm02_00319703 predicted 282
11 SASI_Mm01_00132847 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010946
VALIDATED
NTAN1 MISSION shRNA Bacterial Glycerol Stock
N-terminal asparagine amidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010946.3-636s21c1
Sequence:CCGGCTGCAGAGATTTACAGAGCTTCTCGAGAAGCTCTGTAAATCTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010946.3-612s21c1
Sequence:CCGGATGGCATCGCTGTCAACATTACTCGAGTAATGTTGACAGCGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010946.3-712s21c1
Sequence:CCGGAGGCCCAATGATTAGCATTTACTCGAGTAAATGCTAATCATTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010946.3-1018s21c1
Sequence:CCGGGCTCAGAGTTTACTGAAGAATCTCGAGATTCTTCAGTAAACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010946.3-653s21c1
Sequence:CCGGGCTTCCTTTCAAGATCGTGGTCTCGAGACCACGATCTTGAAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-1016s1c1
Sequence:CCGGGCTCAGAGTTTACTGAAGAATCTCGAGATTCTTCAGTAAACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-634s1c1
Sequence:CCGGCTGCAGAGATTTACAGAGCTTCTCGAGAAGCTCTGTAAATCTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-211s1c1
Sequence:CCGGGCCTTCTGTATGTTCAGCAAACTCGAGTTTGCTGAACATACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010946.2-385s1c1
Sequence:CCGGCCTTGATAATGAGCTCCATAACTCGAGTTATGGAGCTCATTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-651s1c1
Sequence:CCGGGCTTCCTTTCAAGATCGTGGTCTCGAGACCACGATCTTGAAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010946
VALIDATED
NTAN1 MISSION shRNA shRNA Plasmid DNA
N-terminal asparagine amidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010946.3-636s21c1
Sequence:CCGGCTGCAGAGATTTACAGAGCTTCTCGAGAAGCTCTGTAAATCTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010946.3-612s21c1
Sequence:CCGGATGGCATCGCTGTCAACATTACTCGAGTAATGTTGACAGCGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010946.3-712s21c1
Sequence:CCGGAGGCCCAATGATTAGCATTTACTCGAGTAAATGCTAATCATTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010946.3-1018s21c1
Sequence:CCGGGCTCAGAGTTTACTGAAGAATCTCGAGATTCTTCAGTAAACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010946.3-653s21c1
Sequence:CCGGGCTTCCTTTCAAGATCGTGGTCTCGAGACCACGATCTTGAAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-1016s1c1
Sequence:CCGGGCTCAGAGTTTACTGAAGAATCTCGAGATTCTTCAGTAAACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-634s1c1
Sequence:CCGGCTGCAGAGATTTACAGAGCTTCTCGAGAAGCTCTGTAAATCTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-211s1c1
Sequence:CCGGGCCTTCTGTATGTTCAGCAAACTCGAGTTTGCTGAACATACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010946.2-385s1c1
Sequence:CCGGCCTTGATAATGAGCTCCATAACTCGAGTTATGGAGCTCATTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-651s1c1
Sequence:CCGGGCTTCCTTTCAAGATCGTGGTCTCGAGACCACGATCTTGAAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010946
VALIDATED
NTAN1 MISSION shRNA Lentiviral Transduction Particles
N-terminal asparagine amidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010946.3-636s21c1
Sequence:CCGGCTGCAGAGATTTACAGAGCTTCTCGAGAAGCTCTGTAAATCTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010946.3-612s21c1
Sequence:CCGGATGGCATCGCTGTCAACATTACTCGAGTAATGTTGACAGCGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010946.3-712s21c1
Sequence:CCGGAGGCCCAATGATTAGCATTTACTCGAGTAAATGCTAATCATTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010946.3-1018s21c1
Sequence:CCGGGCTCAGAGTTTACTGAAGAATCTCGAGATTCTTCAGTAAACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010946.3-653s21c1
Sequence:CCGGGCTTCCTTTCAAGATCGTGGTCTCGAGACCACGATCTTGAAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-1016s1c1
Sequence:CCGGGCTCAGAGTTTACTGAAGAATCTCGAGATTCTTCAGTAAACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-634s1c1
Sequence:CCGGCTGCAGAGATTTACAGAGCTTCTCGAGAAGCTCTGTAAATCTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-211s1c1
Sequence:CCGGGCCTTCTGTATGTTCAGCAAACTCGAGTTTGCTGAACATACAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010946.2-385s1c1
Sequence:CCGGCCTTGATAATGAGCTCCATAACTCGAGTTATGGAGCTCATTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010946.2-651s1c1
Sequence:CCGGGCTTCCTTTCAAGATCGTGGTCTCGAGACCACGATCTTGAAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173474
VALIDATED
NTAN1 MISSION shRNA Bacterial Glycerol Stock
N-terminal asparagine amidase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173474.2-967s21c1
Sequence:CCGGTCTTGGCCTGACAGACCATTGCTCGAGCAATGGTCTGTCAGGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-492s21c1
Sequence:CCGGGAATTAAATGACCGGGAAGAACTCGAGTTCTTCCCGGTCATTTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-790s21c1
Sequence:CCGGCCCACTTTGTTGAACATATTACTCGAGTAATATGTTCAACAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-731s21c1
Sequence:CCGGGCACCAAGATGACAAGCAAATCTCGAGATTTGCTTGTCATCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-612s21c1
Sequence:CCGGCTTCGTGCTGCGCGAACTTTACTCGAGTAAAGTTCGCGCAGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-731s1c1
Sequence:CCGGGCACCAAGATGACAAGCAAATCTCGAGATTTGCTTGTCATCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-271s1c1
Sequence:CCGGGCTTGACACATTGTGACGGAACTCGAGTTCCGTCACAATGTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-492s1c1
Sequence:CCGGGAATTAAATGACCGGGAAGAACTCGAGTTCTTCCCGGTCATTTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173474.2-208s1c1
Sequence:CCGGGTTCTGATGATGCCACTACTTCTCGAGAAGTAGTGGCATCATCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-790s1c1
Sequence:CCGGCCCACTTTGTTGAACATATTACTCGAGTAATATGTTCAACAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173474
VALIDATED
NTAN1 MISSION shRNA shRNA Plasmid DNA
N-terminal asparagine amidase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173474.2-967s21c1
Sequence:CCGGTCTTGGCCTGACAGACCATTGCTCGAGCAATGGTCTGTCAGGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-492s21c1
Sequence:CCGGGAATTAAATGACCGGGAAGAACTCGAGTTCTTCCCGGTCATTTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-790s21c1
Sequence:CCGGCCCACTTTGTTGAACATATTACTCGAGTAATATGTTCAACAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-731s21c1
Sequence:CCGGGCACCAAGATGACAAGCAAATCTCGAGATTTGCTTGTCATCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-612s21c1
Sequence:CCGGCTTCGTGCTGCGCGAACTTTACTCGAGTAAAGTTCGCGCAGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-731s1c1
Sequence:CCGGGCACCAAGATGACAAGCAAATCTCGAGATTTGCTTGTCATCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-271s1c1
Sequence:CCGGGCTTGACACATTGTGACGGAACTCGAGTTCCGTCACAATGTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-492s1c1
Sequence:CCGGGAATTAAATGACCGGGAAGAACTCGAGTTCTTCCCGGTCATTTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173474.2-208s1c1
Sequence:CCGGGTTCTGATGATGCCACTACTTCTCGAGAAGTAGTGGCATCATCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-790s1c1
Sequence:CCGGCCCACTTTGTTGAACATATTACTCGAGTAATATGTTCAACAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173474
VALIDATED
NTAN1 MISSION shRNA Lentiviral Transduction Particles
N-terminal asparagine amidase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173474.2-967s21c1
Sequence:CCGGTCTTGGCCTGACAGACCATTGCTCGAGCAATGGTCTGTCAGGCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-492s21c1
Sequence:CCGGGAATTAAATGACCGGGAAGAACTCGAGTTCTTCCCGGTCATTTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-790s21c1
Sequence:CCGGCCCACTTTGTTGAACATATTACTCGAGTAATATGTTCAACAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-731s21c1
Sequence:CCGGGCACCAAGATGACAAGCAAATCTCGAGATTTGCTTGTCATCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173474.2-612s21c1
Sequence:CCGGCTTCGTGCTGCGCGAACTTTACTCGAGTAAAGTTCGCGCAGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-731s1c1
Sequence:CCGGGCACCAAGATGACAAGCAAATCTCGAGATTTGCTTGTCATCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-271s1c1
Sequence:CCGGGCTTGACACATTGTGACGGAACTCGAGTTCCGTCACAATGTGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-492s1c1
Sequence:CCGGGAATTAAATGACCGGGAAGAACTCGAGTTCTTCCCGGTCATTTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173474.2-208s1c1
Sequence:CCGGGTTCTGATGATGCCACTACTTCTCGAGAAGTAGTGGCATCATCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173474.2-790s1c1
Sequence:CCGGCCCACTTTGTTGAACATATTACTCGAGTAATATGTTCAACAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks