EMAIL THIS PAGE TO A FRIEND

NTN4

netrin 4

Synonyms: PRO3091
Gene ID:
Human(59277) Summary: NTN4 belongs to a family of proteins related to laminins (see LAMA1, MIM 150320) Koch et al. (2000) [PubMed 11038171]
Mouse(57764) netrin 4
Rat(299737) netrin 4
sheep(780511) netrin 4
chicken(417914) netrin 4
cow(537455) netrin 4
dog(475431) netrin 4
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084771 MISSION® esiRNA esiRNA human NTN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021229 Rosetta Predictions human pricing
NM_001106780 Rosetta Predictions rat pricing
XM_235069 Rosetta Predictions rat pricing
NM_021320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121577 predicted 1073
2 SASI_Hs01_00121578 predicted 799
3 SASI_Hs01_00121579 predicted 831
4 SASI_Hs01_00121580 predicted 2057
5 SASI_Hs01_00121581 predicted 1964
6 SASI_Hs02_00354854 predicted 2069
7 SASI_Hs01_00121583 predicted 608
8 SASI_Hs01_00121584 predicted 2179
9 SASI_Hs01_00121585 predicted 912
10 SASI_Hs02_00354855 predicted 2181
11 SASI_Hs01_00121582 predicted 1856
12 SASI_Hs01_00121586 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222328 predicted 1820
2 SASI_Rn02_00222329 predicted 919
3 SASI_Rn02_00222330 predicted 1667
4 SASI_Rn02_00222331 predicted 1829
5 SASI_Rn02_00222332 predicted 242
6 SASI_Rn02_00222333 predicted 880
7 SASI_Rn02_00222334 predicted 309
8 SASI_Rn02_00222335 predicted 1236
9 SASI_Rn02_00222336 predicted 885
10 SASI_Rn02_00222337 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196122 predicted 277
2 SASI_Rn01_00196123 predicted 280
3 SASI_Rn01_00196124 predicted 288
4 SASI_Rn01_00196125 predicted 247
5 SASI_Rn01_00196126 predicted 248
6 SASI_Rn01_00196127 predicted 283
7 SASI_Rn01_00196128 predicted 290
8 SASI_Rn01_00196129 predicted 283
9 SASI_Rn01_00196130 predicted 234
10 SASI_Rn01_00196131 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127227 predicted 878
2 SASI_Mm01_00127228 predicted 1839
3 SASI_Mm01_00127231 predicted 1007
4 SASI_Mm01_00127232 predicted 391
5 SASI_Mm01_00127233 predicted 710
6 SASI_Mm01_00127234 predicted 362
7 SASI_Mm02_00325875 predicted 1755
8 SASI_Mm02_00325876 predicted 1461
9 SASI_Mm01_00127235 predicted 621
10 SASI_Mm01_00127236 predicted 432
11 SASI_Mm01_00127229 predicted 1383
12 SASI_Mm01_00127230 predicted 1124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021229
VALIDATED
NTN4 MISSION shRNA Bacterial Glycerol Stock
netrin 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-2679s21c1
Sequence:CCGGCTTACGTTTGATGCTACTTAACTCGAGTTAAGTAGCATCAAACGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021229.3-2215s21c1
Sequence:CCGGTAGCAGGACATGAGGATATAACTCGAGTTATATCCTCATGTCCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-2127s21c1
Sequence:CCGGTTCCGAGGAAAGCGAACATTACTCGAGTAATGTTCGCTTTCCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-1467s21c1
Sequence:CCGGACCTGTCACTTCGACGTTAATCTCGAGATTAACGTCGAAGTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021229.3-822s21c1
Sequence:CCGGTTCTACTTCACTCACCTAATTCTCGAGAATTAGGTGAGTGAAGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-1021s21c1
Sequence:CCGGGCACTGGAGGAGAGGTTATTTCTCGAGAAATAACCTCTCCTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021229.2-2851s1c1
Sequence:CCGGGCACTTTACTACCTACCACTTCTCGAGAAGTGGTAGGTAGTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-2240s1c1
Sequence:CCGGACAGGCAAACTAATTGTGAATCTCGAGATTCACAATTAGTTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-984s1c1
Sequence:CCGGGCGCTATTTGTACTTCTAAATCTCGAGATTTAGAAGTACAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-1946s1c1
Sequence:CCGGGCACTTCTACACTCAGGTAAACTCGAGTTTACCTGAGTGTAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-1377s1c1
Sequence:CCGGCGTTATACAATGACCGGCCATCTCGAGATGGCCGGTCATTGTATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021229
VALIDATED
NTN4 MISSION shRNA shRNA Plasmid DNA
netrin 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-2679s21c1
Sequence:CCGGCTTACGTTTGATGCTACTTAACTCGAGTTAAGTAGCATCAAACGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021229.3-2215s21c1
Sequence:CCGGTAGCAGGACATGAGGATATAACTCGAGTTATATCCTCATGTCCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-2127s21c1
Sequence:CCGGTTCCGAGGAAAGCGAACATTACTCGAGTAATGTTCGCTTTCCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-1467s21c1
Sequence:CCGGACCTGTCACTTCGACGTTAATCTCGAGATTAACGTCGAAGTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021229.3-822s21c1
Sequence:CCGGTTCTACTTCACTCACCTAATTCTCGAGAATTAGGTGAGTGAAGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-1021s21c1
Sequence:CCGGGCACTGGAGGAGAGGTTATTTCTCGAGAAATAACCTCTCCTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021229.2-2851s1c1
Sequence:CCGGGCACTTTACTACCTACCACTTCTCGAGAAGTGGTAGGTAGTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-2240s1c1
Sequence:CCGGACAGGCAAACTAATTGTGAATCTCGAGATTCACAATTAGTTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-984s1c1
Sequence:CCGGGCGCTATTTGTACTTCTAAATCTCGAGATTTAGAAGTACAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-1946s1c1
Sequence:CCGGGCACTTCTACACTCAGGTAAACTCGAGTTTACCTGAGTGTAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-1377s1c1
Sequence:CCGGCGTTATACAATGACCGGCCATCTCGAGATGGCCGGTCATTGTATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021229
VALIDATED
NTN4 MISSION shRNA Lentiviral Transduction Particles
netrin 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-2679s21c1
Sequence:CCGGCTTACGTTTGATGCTACTTAACTCGAGTTAAGTAGCATCAAACGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021229.3-2215s21c1
Sequence:CCGGTAGCAGGACATGAGGATATAACTCGAGTTATATCCTCATGTCCTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-2127s21c1
Sequence:CCGGTTCCGAGGAAAGCGAACATTACTCGAGTAATGTTCGCTTTCCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-1467s21c1
Sequence:CCGGACCTGTCACTTCGACGTTAATCTCGAGATTAACGTCGAAGTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021229.3-822s21c1
Sequence:CCGGTTCTACTTCACTCACCTAATTCTCGAGAATTAGGTGAGTGAAGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_021229.3-1021s21c1
Sequence:CCGGGCACTGGAGGAGAGGTTATTTCTCGAGAAATAACCTCTCCTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021229.2-2851s1c1
Sequence:CCGGGCACTTTACTACCTACCACTTCTCGAGAAGTGGTAGGTAGTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-2240s1c1
Sequence:CCGGACAGGCAAACTAATTGTGAATCTCGAGATTCACAATTAGTTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-984s1c1
Sequence:CCGGGCGCTATTTGTACTTCTAAATCTCGAGATTTAGAAGTACAAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-1946s1c1
Sequence:CCGGGCACTTCTACACTCAGGTAAACTCGAGTTTACCTGAGTGTAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021229.2-1377s1c1
Sequence:CCGGCGTTATACAATGACCGGCCATCTCGAGATGGCCGGTCATTGTATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021320
NTN4 MISSION shRNA Bacterial Glycerol Stock
netrin 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021320.3-926s21c1
Sequence:CCGGTTGTCAAGAAGGGAGCTATTTCTCGAGAAATAGCTCCCTTCTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-536s1c1
Sequence:CCGGGCAGACTCATCCTTCAGGTTTCTCGAGAAACCTGAAGGATGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-1806s1c1
Sequence:CCGGCCTTCTGTGGAATGAAGTATTCTCGAGAATACTTCATTCCACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-475s1c1
Sequence:CCGGGCCCAAGTGTGATAAATGCAACTCGAGTTGCATTTATCACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-1758s1c1
Sequence:CCGGACTCAGGTAAATGTGAATGTACTCGAGTACATTCACATTTACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-798s1c1
Sequence:CCGGCGTCTAGATACTCAAATCCTTCTCGAGAAGGATTTGAGTATCTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021320
NTN4 MISSION shRNA shRNA Plasmid DNA
netrin 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021320.3-926s21c1
Sequence:CCGGTTGTCAAGAAGGGAGCTATTTCTCGAGAAATAGCTCCCTTCTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-536s1c1
Sequence:CCGGGCAGACTCATCCTTCAGGTTTCTCGAGAAACCTGAAGGATGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-1806s1c1
Sequence:CCGGCCTTCTGTGGAATGAAGTATTCTCGAGAATACTTCATTCCACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-475s1c1
Sequence:CCGGGCCCAAGTGTGATAAATGCAACTCGAGTTGCATTTATCACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-1758s1c1
Sequence:CCGGACTCAGGTAAATGTGAATGTACTCGAGTACATTCACATTTACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-798s1c1
Sequence:CCGGCGTCTAGATACTCAAATCCTTCTCGAGAAGGATTTGAGTATCTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021320
NTN4 MISSION shRNA Lentiviral Transduction Particles
netrin 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021320.3-926s21c1
Sequence:CCGGTTGTCAAGAAGGGAGCTATTTCTCGAGAAATAGCTCCCTTCTTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-536s1c1
Sequence:CCGGGCAGACTCATCCTTCAGGTTTCTCGAGAAACCTGAAGGATGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-1806s1c1
Sequence:CCGGCCTTCTGTGGAATGAAGTATTCTCGAGAATACTTCATTCCACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-475s1c1
Sequence:CCGGGCCCAAGTGTGATAAATGCAACTCGAGTTGCATTTATCACACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-1758s1c1
Sequence:CCGGACTCAGGTAAATGTGAATGTACTCGAGTACATTCACATTTACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021320.2-798s1c1
Sequence:CCGGCGTCTAGATACTCAAATCCTTCTCGAGAAGGATTTGAGTATCTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks