EMAIL THIS PAGE TO A FRIEND

NTNG1

netrin G1

Synonyms: Lmnt1
Gene ID:
Human(22854) Summary: Netrin G1 (NTNG1) belongs to a conserved family of proteins that act as axon guidance cues during vertebrate nervous system development (Nakashiba et al., 2000 [PubMed 10964959]
Mouse(80883) netrin G1
Rat(295382) netrin G1
sheep(101120121) netrin G1
Zebrafish(569075) netrin G1
chicken(424336) netrin G1
cow(787473) netrin G2
dog(490132) netrin G1
213 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153521 MISSION® esiRNA esiRNA human NTNG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113226 Rosetta Predictions human pricing
NM_001113228 Rosetta Predictions human pricing
NM_014917 Rosetta Predictions human pricing
NM_001106465 Rosetta Predictions rat pricing
NM_030699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325661 predicted 1286
2 SASI_Hs02_00325662 predicted 1509
3 SASI_Hs02_00325663 predicted 966
4 SASI_Hs02_00325664 predicted 897
5 SASI_Hs02_00325665 predicted 1424
6 SASI_Hs02_00325666 predicted 951
7 SASI_Hs02_00325667 predicted 1233
8 SASI_Hs02_00325668 predicted 1318
9 SASI_Hs02_00325669 predicted 1144
10 SASI_Hs02_00325670 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325671 predicted 1285
2 SASI_Hs02_00325672 predicted 1508
3 SASI_Hs02_00325673 predicted 964
4 SASI_Hs02_00325674 predicted 903
5 SASI_Hs02_00325675 predicted 1420
6 SASI_Hs02_00325676 predicted 947
7 SASI_Hs02_00325677 predicted 1233
8 SASI_Hs02_00325678 predicted 1320
9 SASI_Hs02_00325679 predicted 1143
10 SASI_Hs02_00325680 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138194 predicted 1169
2 SASI_Hs01_00138196 predicted 1389
3 SASI_Hs01_00138197 predicted 850
4 SASI_Hs01_00138198 predicted 781
5 SASI_Hs01_00138199 predicted 1305
6 SASI_Hs01_00138200 predicted 837
7 SASI_Hs01_00138201 predicted 1117
8 SASI_Hs01_00138202 predicted 1204
9 SASI_Hs01_00138203 predicted 1031
10 SASI_Hs02_00346564 predicted 1223
11 SASI_Hs01_00138195 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219228 predicted 2496
2 SASI_Rn02_00219229 predicted 2196
3 SASI_Rn02_00219230 predicted 1065
4 SASI_Rn02_00219231 predicted 1048
5 SASI_Rn02_00219232 predicted 1938
6 SASI_Rn02_00219233 predicted 999
7 SASI_Rn02_00219234 predicted 2189
8 SASI_Rn02_00219235 predicted 1303
9 SASI_Rn02_00219236 predicted 1942
10 SASI_Rn02_00219237 predicted 1685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191383 predicted 1583
2 SASI_Mm01_00191384 predicted 2253
3 SASI_Mm01_00191385 predicted 1118
4 SASI_Mm02_00336866 predicted 1418
5 SASI_Mm01_00191387 predicted 1392
6 SASI_Mm01_00191388 predicted 1988
7 SASI_Mm01_00191389 predicted 2237
8 SASI_Mm01_00191390 predicted 1107
9 SASI_Mm01_00191392 predicted 2194
10 SASI_Mm02_00336867 predicted 1307
11 SASI_Mm01_00191386 predicted 1308
12 SASI_Mm01_00191391 predicted 1816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014917
NTNG1 MISSION shRNA Bacterial Glycerol Stock
netrin G1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014917.2-791s21c1
Sequence:CCGGGAAACTCGATCCTCCGGATATCTCGAGATATCCGGAGGATCGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014917.2-2126s21c1
Sequence:CCGGAGTTGGCAGCTGTTGATATTACTCGAGTAATATCAACAGCTGCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014917.2-1189s21c1
Sequence:CCGGTATCACAGCATACGGTCTTAGCTCGAGCTAAGACCGTATGCTGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014917.2-2566s1c1
Sequence:CCGGCCACTATACAAGAGTGGCTATCTCGAGATAGCCACTCTTGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-908s1c1
Sequence:CCGGCCCTGAGCTGATGTTTGATTTCTCGAGAAATCAAACATCAGCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-692s1c1
Sequence:CCGGTGATTTGTGTAAGACTCAGATCTCGAGATCTGAGTCTTACACAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-1031s1c1
Sequence:CCGGGCTAACAGACAACATAGTTATCTCGAGATAACTATGTTGTCTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-1085s1c1
Sequence:CCGGCCTGGAGAAGTCTCTCGATTACTCGAGTAATCGAGAGACTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014917
NTNG1 MISSION shRNA shRNA Plasmid DNA
netrin G1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014917.2-791s21c1
Sequence:CCGGGAAACTCGATCCTCCGGATATCTCGAGATATCCGGAGGATCGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014917.2-2126s21c1
Sequence:CCGGAGTTGGCAGCTGTTGATATTACTCGAGTAATATCAACAGCTGCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014917.2-1189s21c1
Sequence:CCGGTATCACAGCATACGGTCTTAGCTCGAGCTAAGACCGTATGCTGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014917.2-2566s1c1
Sequence:CCGGCCACTATACAAGAGTGGCTATCTCGAGATAGCCACTCTTGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-908s1c1
Sequence:CCGGCCCTGAGCTGATGTTTGATTTCTCGAGAAATCAAACATCAGCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-692s1c1
Sequence:CCGGTGATTTGTGTAAGACTCAGATCTCGAGATCTGAGTCTTACACAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-1031s1c1
Sequence:CCGGGCTAACAGACAACATAGTTATCTCGAGATAACTATGTTGTCTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-1085s1c1
Sequence:CCGGCCTGGAGAAGTCTCTCGATTACTCGAGTAATCGAGAGACTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014917
NTNG1 MISSION shRNA Lentiviral Transduction Particles
netrin G1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014917.2-791s21c1
Sequence:CCGGGAAACTCGATCCTCCGGATATCTCGAGATATCCGGAGGATCGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014917.2-2126s21c1
Sequence:CCGGAGTTGGCAGCTGTTGATATTACTCGAGTAATATCAACAGCTGCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014917.2-1189s21c1
Sequence:CCGGTATCACAGCATACGGTCTTAGCTCGAGCTAAGACCGTATGCTGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014917.2-2566s1c1
Sequence:CCGGCCACTATACAAGAGTGGCTATCTCGAGATAGCCACTCTTGTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-908s1c1
Sequence:CCGGCCCTGAGCTGATGTTTGATTTCTCGAGAAATCAAACATCAGCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-692s1c1
Sequence:CCGGTGATTTGTGTAAGACTCAGATCTCGAGATCTGAGTCTTACACAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-1031s1c1
Sequence:CCGGGCTAACAGACAACATAGTTATCTCGAGATAACTATGTTGTCTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014917.2-1085s1c1
Sequence:CCGGCCTGGAGAAGTCTCTCGATTACTCGAGTAATCGAGAGACTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030699
NTNG1 MISSION shRNA Bacterial Glycerol Stock
netrin G1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030699.1-3272s1c1
Sequence:CCGGCCAGACAATCTGTTAATGTATCTCGAGATACATTAACAGATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-963s1c1
Sequence:CCGGGATGTATGTAAGAGCCTGATTCTCGAGAATCAGGCTCTTACATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-1355s1c1
Sequence:CCGGCCTAGAGAAATCTCTCGACTACTCGAGTAGTCGAGAGATTTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-1776s1c1
Sequence:CCGGCATGCCACTTCGTGTTTGTATCTCGAGATACAAACACGAAGTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-1939s1c1
Sequence:CCGGCCAGCATTTCCAGTATCGGTACTCGAGTACCGATACTGGAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030699
NTNG1 MISSION shRNA shRNA Plasmid DNA
netrin G1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030699.1-3272s1c1
Sequence:CCGGCCAGACAATCTGTTAATGTATCTCGAGATACATTAACAGATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-963s1c1
Sequence:CCGGGATGTATGTAAGAGCCTGATTCTCGAGAATCAGGCTCTTACATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-1355s1c1
Sequence:CCGGCCTAGAGAAATCTCTCGACTACTCGAGTAGTCGAGAGATTTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-1776s1c1
Sequence:CCGGCATGCCACTTCGTGTTTGTATCTCGAGATACAAACACGAAGTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-1939s1c1
Sequence:CCGGCCAGCATTTCCAGTATCGGTACTCGAGTACCGATACTGGAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030699
NTNG1 MISSION shRNA Lentiviral Transduction Particles
netrin G1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030699.1-3272s1c1
Sequence:CCGGCCAGACAATCTGTTAATGTATCTCGAGATACATTAACAGATTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-963s1c1
Sequence:CCGGGATGTATGTAAGAGCCTGATTCTCGAGAATCAGGCTCTTACATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-1355s1c1
Sequence:CCGGCCTAGAGAAATCTCTCGACTACTCGAGTAGTCGAGAGATTTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-1776s1c1
Sequence:CCGGCATGCCACTTCGTGTTTGTATCTCGAGATACAAACACGAAGTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030699.1-1939s1c1
Sequence:CCGGCCAGCATTTCCAGTATCGGTACTCGAGTACCGATACTGGAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks