EMAIL THIS PAGE TO A FRIEND

NTRK3

neurotrophic tyrosine kinase, receptor, type 3

Synonyms: TRKC gp145(trkC)
UniProtKB ID: Q16288, O75682, Q12827, Q16289
Gene ID:
Human(4916) Summary: This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(18213) neurotrophic tyrosine kinase, receptor, type 3
Rat(29613) neurotrophic tyrosine kinase, receptor, type 3
chicken(396081) neurotrophic tyrosine kinase, receptor, type 3
cow(539126) neurotrophic tyrosine kinase, receptor, type 3
Horse(100069852) neurotrophic tyrosine kinase, receptor, type 3
domestic cat(101085548) neurotrophic tyrosine kinase, receptor, type 3
dog(609087) neurotrophic tyrosine kinase, receptor, type 3
domestic guinea pig(100731493) neurotrophic tyrosine kinase, receptor, type 3
naked mole-rat(101723255) neurotrophic tyrosine kinase, receptor, type 3
sheep(101121631) neurotrophic tyrosine kinase, receptor, type 3
208 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302556 ANTI-MOUSE NTRK3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
N9038 Anti-NTRK3 (381-395) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1409383 Anti-NTRK3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2101659 Anti-NTRK3 antibody produced in rabbit affinity isolated antibody mouse, horse, bovine, human, zebrafish, pig, rat, guinea pig, rabbit
western blot pricing
SAB1410849 Anti-NTRK3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA027484 Anti-NTRK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA048065 Anti-NTRK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4504648 Anti-phospho-Trk C (pTyr516) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
T2450 Anti-TrkC antibody produced in goat affinity isolated antibody human
flow cytometry, immunohistochemistry, western blot pricing
SAB1306628 ANTI-TRKC antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1306383 ANTI-TRKC(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB5300229 Monoclonal Anti-NTRK3 antibody produced in mouse clone 7H6, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300230 Monoclonal Anti-NTRK3 antibody produced in mouse clone 4G5, ascites fluid human
ELISA, western blot pricing
SAB1402294 Monoclonal Anti-NTRK3 antibody produced in mouse clone 4D5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

ELISA

Product # Description Species Add to Cart
 
RAB1759 Human TRKC ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002530 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007156 Rosetta Predictions human pricing
NM_001012338 Rosetta Predictions human pricing
NM_002530 Rosetta Predictions human pricing
NM_019248 Rosetta Predictions rat pricing
NM_008746 Rosetta Predictions mouse pricing
NM_182809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192144 predicted 840
2 SASI_Hs01_00192145 predicted 382
3 SASI_Hs01_00192146 predicted 394
4 SASI_Hs01_00192147 predicted 1321
5 SASI_Hs01_00192148 predicted 752
6 SASI_Hs01_00192149 predicted 1211
7 SASI_Hs01_00192150 predicted 368
8 SASI_Hs01_00192151 predicted 1192
9 SASI_Hs01_00192152 predicted 360
10 SASI_Hs01_00192153 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217819 predicted 843
2 SASI_Hs01_00217820 predicted 381
3 SASI_Hs01_00217821 predicted 400
4 SASI_Hs01_00217822 predicted 1323
5 SASI_Hs01_00217823 predicted 753
6 SASI_Hs01_00217824 predicted 1208
7 SASI_Hs01_00217825 predicted 361
8 SASI_Hs01_00217826 predicted 1195
9 SASI_Hs01_00217827 predicted 367
10 SASI_Hs01_00217828 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018725 predicted 842
2 SASI_Hs01_00018726 predicted 383
3 SASI_Hs01_00018727 predicted 402
4 SASI_Hs01_00018728 predicted 1325
5 SASI_Hs01_00018729 predicted 750
6 SASI_Hs01_00018730 predicted 1207
7 SASI_Hs01_00018731 predicted 363
8 SASI_Hs01_00018732 predicted 1194
9 SASI_Hs01_00018733 predicted 367
10 SASI_Hs01_00018734 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049766 predicted 268
2 SASI_Rn01_00049767 predicted 2321
3 SASI_Rn01_00049768 predicted 250
4 SASI_Rn01_00049769 predicted 2102
5 SASI_Rn01_00049770 predicted 1547
6 SASI_Rn01_00049771 predicted 1213
7 SASI_Rn01_00049773 predicted 728
8 SASI_Rn01_00049774 predicted 323
9 SASI_Rn01_00049775 predicted 1103
10 SASI_Rn02_00262123 predicted 431
11 SASI_Rn01_00049772 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314612 predicted 288
2 SASI_Mm01_00162877 predicted 1412
3 SASI_Mm01_00162878 predicted 1075
4 SASI_Mm01_00162881 predicted 1219
5 SASI_Mm01_00162882 predicted 278
6 SASI_Mm01_00162883 predicted 610
7 SASI_Mm02_00314613 predicted 228
8 SASI_Mm01_00162884 predicted 1088
9 SASI_Mm02_00314614 predicted 1297
10 SASI_Mm01_00162879 predicted 262
11 SASI_Mm01_00162875 predicted 228
12 SASI_Mm01_00162876 predicted 687
13 SASI_Mm01_00162880 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349977 predicted 289
2 SASI_Mm01_00192598 predicted 1411
3 SASI_Mm01_00192599 predicted 1072
4 SASI_Mm01_00192602 predicted 1223
5 SASI_Mm01_00192603 predicted 279
6 SASI_Mm01_00192604 predicted 610
7 SASI_Mm02_00349978 predicted 225
8 SASI_Mm01_00192605 predicted 1081
9 SASI_Mm02_00349979 predicted 1298
10 SASI_Mm01_00192600 predicted 261
11 SASI_Mm01_00192596 predicted 431
12 SASI_Mm01_00192597 predicted 889
13 SASI_Mm01_00192601 predicted 589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002530
VALIDATED
NTRK3 MISSION shRNA Bacterial Glycerol Stock
neurotrophic tyrosine kinase, receptor, type 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-2021s21c1
Sequence:CCGGTGAAGCATGGAGACCTGAATACTCGAGTATTCAGGTCTCCATGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-1744s21c1
Sequence:CCGGACGTATGTGCAGCACATTAAGCTCGAGCTTAATGTGCTGCACATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002530.2-2641s1c1
Sequence:CCGGTGGTGGCTGGTGGTCATGAATCTCGAGATTCATGACCACCAGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002530.2-2270s1c1
Sequence:CCGGATGTCTACAGCACGGATTATTCTCGAGAATAATCCGTGCTGTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-2614s21c1
Sequence:CCGGCCAATCTACCTGGACATTCTTCTCGAGAAGAATGTCCAGGTAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-381s21c1
Sequence:CCGGCACGGACATCTCAAGGAATATCTCGAGATATTCCTTGAGATGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-1527s21c1
Sequence:CCGGATATGGTCGACGGTCCAAATTCTCGAGAATTTGGACCGTCGACCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-355s21c1
Sequence:CCGGAGCAATGGGAACGCCAGTATCCTCGAGGATACTGGCGTTCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-275s21c1
Sequence:CCGGGCAGCAAGACTGAGATCAATTCTCGAGAATTGATCTCAGTCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-607s21c1
Sequence:CCGGACGCTGAGTCTTCGGGAATTGCTCGAGCAATTCCCGAAGACTCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002530.2-1373s1c1
Sequence:CCGGCGGATAACTTTATCTTGTTTGCTCGAGCAAACAAGATAAAGTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002530.2-944s1c1
Sequence:CCGGCCAATGTTCATGCCATCAACTCTCGAGAGTTGATGGCATGAACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002530.2-2614s1c1
Sequence:CCGGCCAATCTACCTGGACATTCTTCTCGAGAAGAATGTCCAGGTAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002530.x-2655s1c1
Sequence:CCGGTCATACTCTGTTGCCTCCTCTCTCGAGAGAGGAGGCAACAGAGTATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002530.x-1263s1c1
Sequence:CCGGCACTACAACAATGGCAACTATCTCGAGATAGTTGCCATTGTTGTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002530
VALIDATED
NTRK3 MISSION shRNA shRNA Plasmid DNA
neurotrophic tyrosine kinase, receptor, type 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-2021s21c1
Sequence:CCGGTGAAGCATGGAGACCTGAATACTCGAGTATTCAGGTCTCCATGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-1744s21c1
Sequence:CCGGACGTATGTGCAGCACATTAAGCTCGAGCTTAATGTGCTGCACATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002530.2-2641s1c1
Sequence:CCGGTGGTGGCTGGTGGTCATGAATCTCGAGATTCATGACCACCAGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002530.2-2270s1c1
Sequence:CCGGATGTCTACAGCACGGATTATTCTCGAGAATAATCCGTGCTGTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-2614s21c1
Sequence:CCGGCCAATCTACCTGGACATTCTTCTCGAGAAGAATGTCCAGGTAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-381s21c1
Sequence:CCGGCACGGACATCTCAAGGAATATCTCGAGATATTCCTTGAGATGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-1527s21c1
Sequence:CCGGATATGGTCGACGGTCCAAATTCTCGAGAATTTGGACCGTCGACCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-355s21c1
Sequence:CCGGAGCAATGGGAACGCCAGTATCCTCGAGGATACTGGCGTTCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-275s21c1
Sequence:CCGGGCAGCAAGACTGAGATCAATTCTCGAGAATTGATCTCAGTCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-607s21c1
Sequence:CCGGACGCTGAGTCTTCGGGAATTGCTCGAGCAATTCCCGAAGACTCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002530.2-1373s1c1
Sequence:CCGGCGGATAACTTTATCTTGTTTGCTCGAGCAAACAAGATAAAGTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002530.2-944s1c1
Sequence:CCGGCCAATGTTCATGCCATCAACTCTCGAGAGTTGATGGCATGAACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002530.2-2614s1c1
Sequence:CCGGCCAATCTACCTGGACATTCTTCTCGAGAAGAATGTCCAGGTAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002530.x-2655s1c1
Sequence:CCGGTCATACTCTGTTGCCTCCTCTCTCGAGAGAGGAGGCAACAGAGTATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002530.x-1263s1c1
Sequence:CCGGCACTACAACAATGGCAACTATCTCGAGATAGTTGCCATTGTTGTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002530
VALIDATED
NTRK3 MISSION shRNA Lentiviral Transduction Particles
neurotrophic tyrosine kinase, receptor, type 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-2021s21c1
Sequence:CCGGTGAAGCATGGAGACCTGAATACTCGAGTATTCAGGTCTCCATGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-1744s21c1
Sequence:CCGGACGTATGTGCAGCACATTAAGCTCGAGCTTAATGTGCTGCACATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219678    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002530.2-2641s1c1
Sequence:CCGGTGGTGGCTGGTGGTCATGAATCTCGAGATTCATGACCACCAGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002530.2-2270s1c1
Sequence:CCGGATGTCTACAGCACGGATTATTCTCGAGAATAATCCGTGCTGTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-2614s21c1
Sequence:CCGGCCAATCTACCTGGACATTCTTCTCGAGAAGAATGTCCAGGTAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-381s21c1
Sequence:CCGGCACGGACATCTCAAGGAATATCTCGAGATATTCCTTGAGATGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-1527s21c1
Sequence:CCGGATATGGTCGACGGTCCAAATTCTCGAGAATTTGGACCGTCGACCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-355s21c1
Sequence:CCGGAGCAATGGGAACGCCAGTATCCTCGAGGATACTGGCGTTCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-275s21c1
Sequence:CCGGGCAGCAAGACTGAGATCAATTCTCGAGAATTGATCTCAGTCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002530.2-607s21c1
Sequence:CCGGACGCTGAGTCTTCGGGAATTGCTCGAGCAATTCCCGAAGACTCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002530.2-1373s1c1
Sequence:CCGGCGGATAACTTTATCTTGTTTGCTCGAGCAAACAAGATAAAGTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002530.2-944s1c1
Sequence:CCGGCCAATGTTCATGCCATCAACTCTCGAGAGTTGATGGCATGAACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002530.2-2614s1c1
Sequence:CCGGCCAATCTACCTGGACATTCTTCTCGAGAAGAATGTCCAGGTAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002530.x-2655s1c1
Sequence:CCGGTCATACTCTGTTGCCTCCTCTCTCGAGAGAGGAGGCAACAGAGTATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002530.x-1263s1c1
Sequence:CCGGCACTACAACAATGGCAACTATCTCGAGATAGTTGCCATTGTTGTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008746
NTRK3 MISSION shRNA Bacterial Glycerol Stock
neurotrophic tyrosine kinase, receptor, type 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008746.5-81s21c1
Sequence:CCGGAGTGTAGTTTCTGGCGGATTTCTCGAGAAATCCGCCAGAAACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008746.5-2760s21c1
Sequence:CCGGGTAAGGCAGTTTGACATATATCTCGAGATATATGTCAAACTGCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008746.5-255s21c1
Sequence:CCGGGGAACGCCAGCATCAACATTACTCGAGTAATGTTGATGCTGGCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008746.4-113s1c1
Sequence:CCGGGCAGCAAGACTGAGATCAATTCTCGAGAATTGATCTCAGTCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008746.4-948s1c1
Sequence:CCGGCCTGGAACATTGCATTGAGTTCTCGAGAACTCAATGCAATGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008746.4-1374s1c1
Sequence:CCGGCCGGTCCAAATTTGGAATGAACTCGAGTTCATTCCAAATTTGGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008746
NTRK3 MISSION shRNA shRNA Plasmid DNA
neurotrophic tyrosine kinase, receptor, type 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008746.5-81s21c1
Sequence:CCGGAGTGTAGTTTCTGGCGGATTTCTCGAGAAATCCGCCAGAAACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008746.5-2760s21c1
Sequence:CCGGGTAAGGCAGTTTGACATATATCTCGAGATATATGTCAAACTGCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008746.5-255s21c1
Sequence:CCGGGGAACGCCAGCATCAACATTACTCGAGTAATGTTGATGCTGGCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008746.4-113s1c1
Sequence:CCGGGCAGCAAGACTGAGATCAATTCTCGAGAATTGATCTCAGTCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008746.4-948s1c1
Sequence:CCGGCCTGGAACATTGCATTGAGTTCTCGAGAACTCAATGCAATGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008746.4-1374s1c1
Sequence:CCGGCCGGTCCAAATTTGGAATGAACTCGAGTTCATTCCAAATTTGGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008746
NTRK3 MISSION shRNA Lentiviral Transduction Particles
neurotrophic tyrosine kinase, receptor, type 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008746.5-81s21c1
Sequence:CCGGAGTGTAGTTTCTGGCGGATTTCTCGAGAAATCCGCCAGAAACTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008746.5-2760s21c1
Sequence:CCGGGTAAGGCAGTTTGACATATATCTCGAGATATATGTCAAACTGCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008746.5-255s21c1
Sequence:CCGGGGAACGCCAGCATCAACATTACTCGAGTAATGTTGATGCTGGCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008746.4-113s1c1
Sequence:CCGGGCAGCAAGACTGAGATCAATTCTCGAGAATTGATCTCAGTCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008746.4-948s1c1
Sequence:CCGGCCTGGAACATTGCATTGAGTTCTCGAGAACTCAATGCAATGTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008746.4-1374s1c1
Sequence:CCGGCCGGTCCAAATTTGGAATGAACTCGAGTTCATTCCAAATTTGGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks