EMAIL THIS PAGE TO A FRIEND

NUDC

nudC nuclear distribution protein

Synonyms: HNUDC MNUDC NPD011
UniProtKB ID: Q9Y266, Q5QP31, Q5QP35, Q9H0N2, Q9Y2B6
Gene ID:
Human(10726) Summary: This gene encodes a nuclear distribution protein that plays an essential role in mitosis and cytokinesis. The encoded protein is involved in spindle formation during mitosis and in microtubule organization during cytokinesis. Pseudogenes of this gene are found on chromosome 2. [provided by RefSeq, Feb 2012]
Mouse(18221) nuclear distribution gene C homolog (Aspergillus)
Rat(29648) nudC nuclear distribution protein
fruit fly(39879) CG9710 gene product from transcript CG9710-RB
chicken(419578) nuclear distribution C homolog (A. nidulans)
dog(487349) nuclear distribution C homolog (A. nidulans)
domestic cat(101088010) nuclear distribution C homolog (A. nidulans)
Zebrafish(393893) nuclear distribution gene C homolog
cow(513277) nuclear distribution gene C homolog (A. nidulans)
naked mole-rat(101720892) nuclear distribution C homolog (A. nidulans)
domestic guinea pig(100726019) nuclear distribution C homolog (A. nidulans)
sheep(101109337) nuclear distribution C homolog (A. nidulans)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006600 Rosetta Predictions human pricing
NM_017271 Rosetta Predictions rat pricing
NM_010948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025987 predicted 905
2 SASI_Hs01_00025988 predicted 284
3 SASI_Hs01_00025990 predicted 619
4 SASI_Hs01_00025991 predicted 1046
5 SASI_Hs01_00025992 predicted 531
6 SASI_Hs01_00025993 predicted 536
7 SASI_Hs01_00025994 predicted 1014
8 SASI_Hs01_00025996 predicted 838
9 SASI_Hs02_00341919 predicted 1050
10 SASI_Hs02_00341920 predicted 305
11 SASI_Hs01_00025989 predicted 806
12 SASI_Hs01_00025995 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088863 predicted 509
2 SASI_Rn01_00088864 predicted 420
3 SASI_Rn01_00088865 predicted 877
4 SASI_Rn01_00088866 predicted 372
5 SASI_Rn02_00261680 predicted 1058
6 SASI_Rn01_00088867 predicted 537
7 SASI_Rn01_00088868 predicted 898
8 SASI_Rn01_00088870 predicted 814
9 SASI_Rn01_00088871 predicted 486
10 SASI_Rn01_00088872 predicted 652
11 SASI_Rn01_00088869 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142759 predicted 657
2 SASI_Mm01_00142760 predicted 693
3 SASI_Mm01_00142761 predicted 871
4 SASI_Mm02_00319704 predicted 892
5 SASI_Mm01_00142762 predicted 716
6 SASI_Mm01_00142763 predicted 411
7 SASI_Mm01_00142764 predicted 271
8 SASI_Mm01_00142765 predicted 963
9 SASI_Mm01_00142766 predicted 243
10 SASI_Mm01_00142767 predicted 484
11 SASI_Mm01_00142768 predicted 813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010948
VALIDATED
NUDC MISSION shRNA Bacterial Glycerol Stock
nudC nuclear distribution protein
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-734s1c1
Sequence:CCGGGTTGATGGAGAACTCTACAATCTCGAGATTGTAGAGTTCTCCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-737s1c1
Sequence:CCGGGATGGAGAACTCTACAATGAACTCGAGTTCATTGTAGAGTTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-826s1c1
Sequence:CCGGCAATAAGATGGAATGGTGGAACTCGAGTTCCACCATTCCATCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010948.1-995s1c1
Sequence:CCGGGATGAGCAGAAGAAACAGGAACTCGAGTTCCTGTTTCTTCTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-424s1c1
Sequence:CCGGGCAACTGGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-868s1c1
Sequence:CCGGCGAAATCAATACCAAGAAGATCTCGAGATCTTCTTGGTATTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-818s1c1
Sequence:CCGGGAGAAGATCAATAAGATGGAACTCGAGTTCCATCTTATTGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-456s21c1
Sequence:CCGGGCAACTGGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010948.2-900s21c1
Sequence:CCGGCGAAATCAATACCAAGAAGATCTCGAGATCTTCTTGGTATTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010948.1-1091s1c1
Sequence:CCGGCCTTCCTGAACTCTTGCAATTCTCGAGAATTGCAAGAGTTCAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-388s1c1
Sequence:CCGGGATCAAGGAGTTGACTGATGACTCGAGTCATCAGTCAACTCCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-1052s1c1
Sequence:CCGGGATTTCTCCAAGGCCAAATTCCTCGAGGAATTTGGCCTTGGAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-418s21c1
Sequence:CCGGCAGATCAAGGAGTTGACTGATCTCGAGATCAGTCAACTCCTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-271s21c1
Sequence:CCGGCTGATCACACAGACTTTCAACCTCGAGGTTGAAAGTCTGTGTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-766s21c1
Sequence:CCGGGTTGATGGAGAACTCTACAATCTCGAGATTGTAGAGTTCTCCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010948
VALIDATED
NUDC MISSION shRNA shRNA Plasmid DNA
nudC nuclear distribution protein
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-734s1c1
Sequence:CCGGGTTGATGGAGAACTCTACAATCTCGAGATTGTAGAGTTCTCCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-737s1c1
Sequence:CCGGGATGGAGAACTCTACAATGAACTCGAGTTCATTGTAGAGTTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-826s1c1
Sequence:CCGGCAATAAGATGGAATGGTGGAACTCGAGTTCCACCATTCCATCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010948.1-995s1c1
Sequence:CCGGGATGAGCAGAAGAAACAGGAACTCGAGTTCCTGTTTCTTCTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-424s1c1
Sequence:CCGGGCAACTGGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-868s1c1
Sequence:CCGGCGAAATCAATACCAAGAAGATCTCGAGATCTTCTTGGTATTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-818s1c1
Sequence:CCGGGAGAAGATCAATAAGATGGAACTCGAGTTCCATCTTATTGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-456s21c1
Sequence:CCGGGCAACTGGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010948.2-900s21c1
Sequence:CCGGCGAAATCAATACCAAGAAGATCTCGAGATCTTCTTGGTATTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010948.1-1091s1c1
Sequence:CCGGCCTTCCTGAACTCTTGCAATTCTCGAGAATTGCAAGAGTTCAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-388s1c1
Sequence:CCGGGATCAAGGAGTTGACTGATGACTCGAGTCATCAGTCAACTCCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-1052s1c1
Sequence:CCGGGATTTCTCCAAGGCCAAATTCCTCGAGGAATTTGGCCTTGGAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-418s21c1
Sequence:CCGGCAGATCAAGGAGTTGACTGATCTCGAGATCAGTCAACTCCTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-271s21c1
Sequence:CCGGCTGATCACACAGACTTTCAACCTCGAGGTTGAAAGTCTGTGTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-766s21c1
Sequence:CCGGGTTGATGGAGAACTCTACAATCTCGAGATTGTAGAGTTCTCCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010948
VALIDATED
NUDC MISSION shRNA Lentiviral Transduction Particles
nudC nuclear distribution protein
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-734s1c1
Sequence:CCGGGTTGATGGAGAACTCTACAATCTCGAGATTGTAGAGTTCTCCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-737s1c1
Sequence:CCGGGATGGAGAACTCTACAATGAACTCGAGTTCATTGTAGAGTTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-826s1c1
Sequence:CCGGCAATAAGATGGAATGGTGGAACTCGAGTTCCACCATTCCATCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010948.1-995s1c1
Sequence:CCGGGATGAGCAGAAGAAACAGGAACTCGAGTTCCTGTTTCTTCTGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-424s1c1
Sequence:CCGGGCAACTGGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010948.1-868s1c1
Sequence:CCGGCGAAATCAATACCAAGAAGATCTCGAGATCTTCTTGGTATTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-818s1c1
Sequence:CCGGGAGAAGATCAATAAGATGGAACTCGAGTTCCATCTTATTGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-456s21c1
Sequence:CCGGGCAACTGGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010948.2-900s21c1
Sequence:CCGGCGAAATCAATACCAAGAAGATCTCGAGATCTTCTTGGTATTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217154    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010948.1-1091s1c1
Sequence:CCGGCCTTCCTGAACTCTTGCAATTCTCGAGAATTGCAAGAGTTCAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-388s1c1
Sequence:CCGGGATCAAGGAGTTGACTGATGACTCGAGTCATCAGTCAACTCCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010948.1-1052s1c1
Sequence:CCGGGATTTCTCCAAGGCCAAATTCCTCGAGGAATTTGGCCTTGGAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-418s21c1
Sequence:CCGGCAGATCAAGGAGTTGACTGATCTCGAGATCAGTCAACTCCTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-271s21c1
Sequence:CCGGCTGATCACACAGACTTTCAACCTCGAGGTTGAAAGTCTGTGTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010948.2-766s21c1
Sequence:CCGGGTTGATGGAGAACTCTACAATCTCGAGATTGTAGAGTTCTCCATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006600
VALIDATED
NUDC MISSION shRNA Bacterial Glycerol Stock
nudC nuclear distribution protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006600.2-903s1c1
Sequence:CCGGGAGATCAACACCAAGAAGATTCTCGAGAATCTTCTTGGTGTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-914s1c1
Sequence:CCGGCAAGAAGATTAACCCTGAGAACTCGAGTTCTCAGGGTTAATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-1055s1c1
Sequence:CCGGGAAGAAGTTCATGGATCAACACTCGAGTGTTGATCCATGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-272s1c1
Sequence:CCGGGAAGCTTATCACACAGACTTTCTCGAGAAAGTCTGTGTGATAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-1159s1c1
Sequence:CCGGCCAACTTTCTTTCCCACTCTTCTCGAGAAGAGTGGGAAAGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006600.2-914s21c1
Sequence:CCGGCAAGAAGATTAACCCTGAGAACTCGAGTTCTCAGGGTTAATCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006600.2-272s21c1
Sequence:CCGGGAAGCTTATCACACAGACTTTCTCGAGAAAGTCTGTGTGATAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006600.2-1159s21c1
Sequence:CCGGCCAACTTTCTTTCCCACTCTTCTCGAGAAGAGTGGGAAAGAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006600.2-903s21c1
Sequence:CCGGGAGATCAACACCAAGAAGATTCTCGAGAATCTTCTTGGTGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006600
VALIDATED
NUDC MISSION shRNA shRNA Plasmid DNA
nudC nuclear distribution protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006600.2-903s1c1
Sequence:CCGGGAGATCAACACCAAGAAGATTCTCGAGAATCTTCTTGGTGTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-914s1c1
Sequence:CCGGCAAGAAGATTAACCCTGAGAACTCGAGTTCTCAGGGTTAATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-1055s1c1
Sequence:CCGGGAAGAAGTTCATGGATCAACACTCGAGTGTTGATCCATGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-272s1c1
Sequence:CCGGGAAGCTTATCACACAGACTTTCTCGAGAAAGTCTGTGTGATAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-1159s1c1
Sequence:CCGGCCAACTTTCTTTCCCACTCTTCTCGAGAAGAGTGGGAAAGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006600.2-914s21c1
Sequence:CCGGCAAGAAGATTAACCCTGAGAACTCGAGTTCTCAGGGTTAATCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006600.2-272s21c1
Sequence:CCGGGAAGCTTATCACACAGACTTTCTCGAGAAAGTCTGTGTGATAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006600.2-1159s21c1
Sequence:CCGGCCAACTTTCTTTCCCACTCTTCTCGAGAAGAGTGGGAAAGAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006600.2-903s21c1
Sequence:CCGGGAGATCAACACCAAGAAGATTCTCGAGAATCTTCTTGGTGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006600
VALIDATED
NUDC MISSION shRNA Lentiviral Transduction Particles
nudC nuclear distribution protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006600.2-903s1c1
Sequence:CCGGGAGATCAACACCAAGAAGATTCTCGAGAATCTTCTTGGTGTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-914s1c1
Sequence:CCGGCAAGAAGATTAACCCTGAGAACTCGAGTTCTCAGGGTTAATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-1055s1c1
Sequence:CCGGGAAGAAGTTCATGGATCAACACTCGAGTGTTGATCCATGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-272s1c1
Sequence:CCGGGAAGCTTATCACACAGACTTTCTCGAGAAAGTCTGTGTGATAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006600.2-1159s1c1
Sequence:CCGGCCAACTTTCTTTCCCACTCTTCTCGAGAAGAGTGGGAAAGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006600.2-914s21c1
Sequence:CCGGCAAGAAGATTAACCCTGAGAACTCGAGTTCTCAGGGTTAATCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006600.2-272s21c1
Sequence:CCGGGAAGCTTATCACACAGACTTTCTCGAGAAAGTCTGTGTGATAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006600.2-1159s21c1
Sequence:CCGGCCAACTTTCTTTCCCACTCTTCTCGAGAAGAGTGGGAAAGAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006600.2-903s21c1
Sequence:CCGGGAGATCAACACCAAGAAGATTCTCGAGAATCTTCTTGGTGTTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks