EMAIL THIS PAGE TO A FRIEND

NUDT6

nudix (nucleoside diphosphate linked moiety X)-type motif 6

Synonyms: ASFGF2 FGF-AS FGF2AS GFG-1 GFG1
UniProtKB ID: P53370, A8K756, O95097, Q9UQD9
Gene ID:
Human(11162) Summary: This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(229228) nudix (nucleoside diphosphate linked moiety X)-type motif 6
Rat(207120) nudix (nucleoside diphosphate linked moiety X)-type motif 6
domestic guinea pig(100721457) nudix (nucleoside diphosphate linked moiety X)-type motif 6
naked mole-rat(101721875) nudix (nucleoside diphosphate linked moiety X)-type motif 6
sheep(101103092) nudix (nucleoside diphosphate linked moiety X)-type motif 6
Thale Cress(814985) nudix hydrolase 6
cow(100126047) nudix (nucleoside diphosphate linked moiety X)-type motif 6
domestic cat(101089855) nudix (nucleoside diphosphate linked moiety X)-type motif 6
dog(483841) nudix (nucleoside diphosphate linked moiety X)-type motif 6
chicken(422666) nudix (nucleoside diphosphate linked moiety X)-type motif 6
Zebrafish(100037370) nudix (nucleoside diphosphate linked moiety X)-type motif 6
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007083 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007083 Rosetta Predictions human pricing
NM_198041 Rosetta Predictions human pricing
NM_181363 Rosetta Predictions rat pricing
NM_153561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062125 predicted 717
2 SASI_Hs01_00062126 predicted 560
3 SASI_Hs01_00062127 predicted 659
4 SASI_Hs01_00062128 predicted 761
5 SASI_Hs01_00062129 predicted 475
6 SASI_Hs01_00062130 predicted 658
7 SASI_Hs01_00062131 predicted 933
8 SASI_Hs01_00062132 predicted 623
9 SASI_Hs01_00062133 predicted 581
10 SASI_Hs01_00062134 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229338 predicted 604
2 SASI_Hs01_00229339 predicted 619
3 SASI_Hs01_00229340 predicted 461
4 SASI_Hs02_00371600 predicted 603
5 SASI_Hs01_00229341 predicted 834
6 SASI_Hs01_00229343 predicted 663
7 SASI_Hs02_00371601 predicted 830
8 SASI_Hs01_00229344 predicted 523
9 SASI_Hs01_00229346 predicted 656
10 SASI_Hs02_00371602 predicted 649
11 SASI_Hs01_00229342 predicted 806
12 SASI_Hs01_00229345 predicted 485
13 SASI_Hs01_00229347 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107635 predicted 484
2 SASI_Rn01_00107636 predicted 819
3 SASI_Rn01_00107638 predicted 608
4 SASI_Rn02_00269680 predicted 490
5 SASI_Rn02_00269681 predicted 757
6 SASI_Rn01_00107640 predicted 493
7 SASI_Rn01_00107641 predicted 838
8 SASI_Rn01_00107642 predicted 737
9 SASI_Rn02_00269682 predicted 497
10 SASI_Rn02_00269683 predicted 495
11 SASI_Rn01_00107637 predicted 760
12 SASI_Rn01_00107639 predicted 377
13 SASI_Rn01_00107643 predicted 249
14 SASI_Rn01_00107644 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343345 predicted 470
2 SASI_Mm02_00343346 predicted 733
3 SASI_Mm02_00343347 predicted 417
4 SASI_Mm02_00343348 predicted 731
5 SASI_Mm02_00343349 predicted 485
6 SASI_Mm02_00343350 predicted 441
7 SASI_Mm02_00343351 predicted 408
8 SASI_Mm02_00343352 predicted 585
9 SASI_Mm02_00343353 predicted 615
10 SASI_Mm02_00343354 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007083
VALIDATED
NUDT6 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-465s21c1
Sequence:GTACCGGGGAGTTGCAGGAGCTGTATTTCTCGAGAAATACAGCTCCTGCAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-371s21c1
Sequence:CCGGCTGCTTTCACCACGCAGAATCCTCGAGGATTCTGCGTGGTGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-325s21c1
Sequence:CCGGCCATCCTCCAAAGCCGATTTACTCGAGTAAATCGGCTTTGGAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007083.3-722s21c1
Sequence:CCGGGCCATATTCATTCACCATAAACTCGAGTTTATGGTGAATGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-509s21c1
Sequence:CCGGGGTTGTACAAGATCGAAATAACTCGAGTTATTTCGATCTTGTACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007083.3-433s21c1
Sequence:CCGGGCAGATTACCAGGATATGCTTCTCGAGAAGCATATCCTGGTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007083.3-325s1c1
Sequence:CCGGCCATCCTCCAAAGCCGATTTACTCGAGTAAATCGGCTTTGGAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007083.3-126s1c1
Sequence:CCGGGCACAGGGTTACGTGCGGAATCTCGAGATTCCGCACGTAACCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007083.3-722s1c1
Sequence:CCGGGCCATATTCATTCACCATAAACTCGAGTTTATGGTGAATGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007083.3-433s1c1
Sequence:CCGGGCAGATTACCAGGATATGCTTCTCGAGAAGCATATCCTGGTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007083.3-450s1c1
Sequence:CCGGGCTTCACATCAAGTAGGAGTTCTCGAGAACTCCTACTTGATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007083
VALIDATED
NUDT6 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-465s21c1
Sequence:GTACCGGGGAGTTGCAGGAGCTGTATTTCTCGAGAAATACAGCTCCTGCAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-371s21c1
Sequence:CCGGCTGCTTTCACCACGCAGAATCCTCGAGGATTCTGCGTGGTGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-325s21c1
Sequence:CCGGCCATCCTCCAAAGCCGATTTACTCGAGTAAATCGGCTTTGGAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007083.3-722s21c1
Sequence:CCGGGCCATATTCATTCACCATAAACTCGAGTTTATGGTGAATGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-509s21c1
Sequence:CCGGGGTTGTACAAGATCGAAATAACTCGAGTTATTTCGATCTTGTACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007083.3-433s21c1
Sequence:CCGGGCAGATTACCAGGATATGCTTCTCGAGAAGCATATCCTGGTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007083.3-325s1c1
Sequence:CCGGCCATCCTCCAAAGCCGATTTACTCGAGTAAATCGGCTTTGGAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007083.3-126s1c1
Sequence:CCGGGCACAGGGTTACGTGCGGAATCTCGAGATTCCGCACGTAACCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007083.3-722s1c1
Sequence:CCGGGCCATATTCATTCACCATAAACTCGAGTTTATGGTGAATGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007083.3-433s1c1
Sequence:CCGGGCAGATTACCAGGATATGCTTCTCGAGAAGCATATCCTGGTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007083.3-450s1c1
Sequence:CCGGGCTTCACATCAAGTAGGAGTTCTCGAGAACTCCTACTTGATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007083
VALIDATED
NUDT6 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-465s21c1
Sequence:GTACCGGGGAGTTGCAGGAGCTGTATTTCTCGAGAAATACAGCTCCTGCAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-371s21c1
Sequence:CCGGCTGCTTTCACCACGCAGAATCCTCGAGGATTCTGCGTGGTGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-325s21c1
Sequence:CCGGCCATCCTCCAAAGCCGATTTACTCGAGTAAATCGGCTTTGGAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007083.3-722s21c1
Sequence:CCGGGCCATATTCATTCACCATAAACTCGAGTTTATGGTGAATGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_007083.3-509s21c1
Sequence:CCGGGGTTGTACAAGATCGAAATAACTCGAGTTATTTCGATCTTGTACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007083.3-433s21c1
Sequence:CCGGGCAGATTACCAGGATATGCTTCTCGAGAAGCATATCCTGGTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007083.3-325s1c1
Sequence:CCGGCCATCCTCCAAAGCCGATTTACTCGAGTAAATCGGCTTTGGAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007083.3-126s1c1
Sequence:CCGGGCACAGGGTTACGTGCGGAATCTCGAGATTCCGCACGTAACCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_007083.3-722s1c1
Sequence:CCGGGCCATATTCATTCACCATAAACTCGAGTTTATGGTGAATGAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007083.3-433s1c1
Sequence:CCGGGCAGATTACCAGGATATGCTTCTCGAGAAGCATATCCTGGTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007083.3-450s1c1
Sequence:CCGGGCTTCACATCAAGTAGGAGTTCTCGAGAACTCCTACTTGATGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153561
VALIDATED
NUDT6 MISSION shRNA Bacterial Glycerol Stock
nudix (nucleoside diphosphate linked moiety X)-type motif 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-925s21c1
Sequence:CCGGCGGAGAGTTACAAAGCCGCAACTCGAGTTGCGGCTTTGTAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-47s21c1
Sequence:CCGGCTGGTTCTCCACATTGCTTTACTCGAGTAAAGCAATGTGGAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-695s21c1
Sequence:CCGGGCAGCCTCGTTCCTTCACTATCTCGAGATAGTGAAGGAACGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-593s21c1
Sequence:CCGGGACTGGTGTCAAGTCAGAATTCTCGAGAATTCTGACTTGACACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-695s1c1
Sequence:CCGGGCAGCCTCGTTCCTTCACTATCTCGAGATAGTGAAGGAACGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-925s1c1
Sequence:CCGGCGGAGAGTTACAAAGCCGCAACTCGAGTTGCGGCTTTGTAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-593s1c1
Sequence:CCGGGACTGGTGTCAAGTCAGAATTCTCGAGAATTCTGACTTGACACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-47s1c1
Sequence:CCGGCTGGTTCTCCACATTGCTTTACTCGAGTAAAGCAATGTGGAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-451s1c1
Sequence:CCGGCAGGTGCTGTATTTGATGTTACTCGAGTAACATCAAATACAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153561
VALIDATED
NUDT6 MISSION shRNA shRNA Plasmid DNA
nudix (nucleoside diphosphate linked moiety X)-type motif 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-925s21c1
Sequence:CCGGCGGAGAGTTACAAAGCCGCAACTCGAGTTGCGGCTTTGTAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-47s21c1
Sequence:CCGGCTGGTTCTCCACATTGCTTTACTCGAGTAAAGCAATGTGGAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-695s21c1
Sequence:CCGGGCAGCCTCGTTCCTTCACTATCTCGAGATAGTGAAGGAACGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-593s21c1
Sequence:CCGGGACTGGTGTCAAGTCAGAATTCTCGAGAATTCTGACTTGACACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-695s1c1
Sequence:CCGGGCAGCCTCGTTCCTTCACTATCTCGAGATAGTGAAGGAACGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-925s1c1
Sequence:CCGGCGGAGAGTTACAAAGCCGCAACTCGAGTTGCGGCTTTGTAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-593s1c1
Sequence:CCGGGACTGGTGTCAAGTCAGAATTCTCGAGAATTCTGACTTGACACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-47s1c1
Sequence:CCGGCTGGTTCTCCACATTGCTTTACTCGAGTAAAGCAATGTGGAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-451s1c1
Sequence:CCGGCAGGTGCTGTATTTGATGTTACTCGAGTAACATCAAATACAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153561
VALIDATED
NUDT6 MISSION shRNA Lentiviral Transduction Particles
nudix (nucleoside diphosphate linked moiety X)-type motif 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-925s21c1
Sequence:CCGGCGGAGAGTTACAAAGCCGCAACTCGAGTTGCGGCTTTGTAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-47s21c1
Sequence:CCGGCTGGTTCTCCACATTGCTTTACTCGAGTAAAGCAATGTGGAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-695s21c1
Sequence:CCGGGCAGCCTCGTTCCTTCACTATCTCGAGATAGTGAAGGAACGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153561.2-593s21c1
Sequence:CCGGGACTGGTGTCAAGTCAGAATTCTCGAGAATTCTGACTTGACACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-695s1c1
Sequence:CCGGGCAGCCTCGTTCCTTCACTATCTCGAGATAGTGAAGGAACGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-925s1c1
Sequence:CCGGCGGAGAGTTACAAAGCCGCAACTCGAGTTGCGGCTTTGTAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-593s1c1
Sequence:CCGGGACTGGTGTCAAGTCAGAATTCTCGAGAATTCTGACTTGACACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-47s1c1
Sequence:CCGGCTGGTTCTCCACATTGCTTTACTCGAGTAAAGCAATGTGGAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153561.1-451s1c1
Sequence:CCGGCAGGTGCTGTATTTGATGTTACTCGAGTAACATCAAATACAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks