EMAIL THIS PAGE TO A FRIEND

NUP205

nucleoporin 205kDa

Synonyms: C7orf14
UniProtKB ID: Q92621, A6H8X3, Q86YC1
Gene ID:
Mouse(70699) nucleoporin 205
Rat(362335) nucleoporin 205
sheep(101101887) nucleoporin 205kDa
naked mole-rat(101705038) nucleoporin 205kDa
domestic guinea pig(100723846) nucleoporin 205kDa
fruit fly(33002) Nucleoporin 205
Zebrafish(445382) nucleoporin 205
cow(520924) nucleoporin 205kDa
domestic cat(101097383) nucleoporin 205kDa
dog(475506) nucleoporin 205kDa
chicken(417935) nucleoporin 205kDa
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA024574 Anti-NUP205 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015135 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015135 Rosetta Predictions human pricing
NM_001108620 Rosetta Predictions rat pricing
XM_133073 Rosetta Predictions mouse pricing
XM_896127 Rosetta Predictions mouse pricing
XM_896136 Rosetta Predictions mouse pricing
XM_896150 Rosetta Predictions mouse pricing
XM_896165 Rosetta Predictions mouse pricing
XM_896171 Rosetta Predictions mouse pricing
XM_896178 Rosetta Predictions mouse pricing
XM_896188 Rosetta Predictions mouse pricing
XM_896198 Rosetta Predictions mouse pricing
XM_896207 Rosetta Predictions mouse pricing
XM_911723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225535 predicted 2711
2 SASI_Hs01_00225537 predicted 3921
3 SASI_Hs01_00225538 predicted 3355
4 SASI_Hs01_00225539 predicted 2745
5 SASI_Hs01_00225541 predicted 4706
6 SASI_Hs01_00225543 predicted 4559
7 SASI_Hs01_00225544 predicted 5740
8 SASI_Hs02_00347060 predicted 3685
9 SASI_Hs02_00347061 predicted 5683
10 SASI_Hs02_00347062 predicted 1012
11 SASI_Hs01_00225536 predicted 4597
12 SASI_Hs01_00225540 predicted 1255
13 SASI_Hs01_00225542 predicted 3008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240429 predicted 5738
2 SASI_Rn02_00240430 predicted 3304
3 SASI_Rn02_00240431 predicted 1791
4 SASI_Rn02_00240432 predicted 4575
5 SASI_Rn02_00240433 predicted 5279
6 SASI_Rn02_00240434 predicted 5946
7 SASI_Rn02_00240435 predicted 4688
8 SASI_Rn02_00240436 predicted 2403
9 SASI_Rn02_00240437 predicted 5859
10 SASI_Rn02_00240438 predicted 5965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211522 predicted 6079
2 SASI_Mm01_00211523 predicted 3980
3 SASI_Mm01_00211524 predicted 4295
4 SASI_Mm02_00424512 predicted 5920
5 SASI_Mm01_00211525 predicted 2166
6 SASI_Mm01_00211527 predicted 674
7 SASI_Mm01_00211528 predicted 246
8 SASI_Mm01_00211529 predicted 3760
9 SASI_Mm01_00211530 predicted 2919
10 SASI_Mm01_00211531 predicted 5805
11 SASI_Mm01_00211526 predicted 5595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228559 predicted 1619
2 SASI_Mm01_00228560 predicted 455
3 SASI_Mm01_00228561 predicted 1799
4 SASI_Mm01_00228562 predicted 578
5 SASI_Mm01_00228563 predicted 828
6 SASI_Mm01_00228564 predicted 1987
7 SASI_Mm01_00228565 predicted 1824
8 SASI_Mm01_00228566 predicted 491
9 SASI_Mm01_00228567 predicted 250
10 SASI_Mm01_00228568 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202337 predicted 815
2 SASI_Mm01_00202338 predicted 450
3 SASI_Mm01_00202339 predicted 577
4 SASI_Mm01_00202340 predicted 828
5 SASI_Mm01_00202341 predicted 756
6 SASI_Mm01_00202342 predicted 487
7 SASI_Mm01_00202343 predicted 437
8 SASI_Mm01_00202344 predicted 460
9 SASI_Mm01_00202345 predicted 249
10 SASI_Mm01_00202346 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283724 predicted 229
2 SASI_Mm01_00283725 predicted 211
3 SASI_Mm01_00283726 predicted 236
4 SASI_Mm01_00283727 predicted 340
5 SASI_Mm01_00283728 predicted 299
6 SASI_Mm01_00283729 predicted 350
7 SASI_Mm01_00283730 predicted 282
8 SASI_Mm01_00283731 predicted 232
9 SASI_Mm01_00283732 predicted 218
10 SASI_Mm01_00283733 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208464 predicted 218
2 SASI_Mm01_00208465 predicted 219
3 SASI_Mm01_00208466 predicted 217
4 SASI_Mm01_00208467 predicted 232
5 SASI_Mm01_00208468 predicted 237
6 SASI_Mm01_00208469 predicted 219
7 SASI_Mm01_00208470 predicted 263
8 SASI_Mm01_00208471 predicted 147
9 SASI_Mm01_00208472 predicted 324
10 SASI_Mm01_00208473 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274514 predicted 981
2 SASI_Mm01_00274515 predicted 1054
3 SASI_Mm01_00274516 predicted 1036
4 SASI_Mm01_00274517 predicted 989
5 SASI_Mm01_00274518 predicted 919
6 SASI_Mm01_00274519 predicted 880
7 SASI_Mm01_00274520 predicted 974
8 SASI_Mm01_00274521 predicted 997
9 SASI_Mm01_00274522 predicted 947
10 SASI_Mm01_00274523 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218981 predicted 1991
2 SASI_Mm01_00218982 predicted 1481
3 SASI_Mm01_00218983 predicted 2042
4 SASI_Mm01_00218984 predicted 1836
5 SASI_Mm01_00218985 predicted 1053
6 SASI_Mm01_00218986 predicted 1497
7 SASI_Mm01_00218987 predicted 1386
8 SASI_Mm01_00218988 predicted 1680
9 SASI_Mm01_00218989 predicted 1067
10 SASI_Mm01_00218990 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276721 predicted 2152
2 SASI_Mm01_00276722 predicted 1649
3 SASI_Mm01_00276723 predicted 362
4 SASI_Mm01_00276724 predicted 2197
5 SASI_Mm01_00276725 predicted 1992
6 SASI_Mm01_00276726 predicted 375
7 SASI_Mm01_00276727 predicted 1205
8 SASI_Mm01_00276728 predicted 1661
9 SASI_Mm01_00276729 predicted 1846
10 SASI_Mm01_00276730 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251196 predicted 2803
2 SASI_Mm01_00251197 predicted 706
3 SASI_Mm01_00251198 predicted 216
4 SASI_Mm01_00251199 predicted 1022
5 SASI_Mm01_00251200 predicted 2856
6 SASI_Mm01_00251201 predicted 2657
7 SASI_Mm01_00251202 predicted 2320
8 SASI_Mm01_00251203 predicted 602
9 SASI_Mm01_00251204 predicted 612
10 SASI_Mm01_00251205 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278205 predicted 4179
2 SASI_Mm01_00278206 predicted 2083
3 SASI_Mm01_00278207 predicted 1591
4 SASI_Mm01_00278208 predicted 2394
5 SASI_Mm01_00278209 predicted 4234
6 SASI_Mm01_00278210 predicted 4028
7 SASI_Mm01_00278211 predicted 3687
8 SASI_Mm01_00278212 predicted 1982
9 SASI_Mm01_00278213 predicted 1990
10 SASI_Mm01_00278214 predicted 1857
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436588 predicted 6074
2 SASI_Mm02_00436589 predicted 3973
3 SASI_Mm02_00436590 predicted 4292
4 SASI_Mm02_00436591 predicted 5925
5 SASI_Mm02_00436592 predicted 2167
6 SASI_Mm02_00436593 predicted 666
7 SASI_Mm02_00436594 predicted 242
8 SASI_Mm02_00436595 predicted 3755
9 SASI_Mm02_00436596 predicted 2919
10 SASI_Mm02_00436597 predicted 5802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371954
VALIDATED
NUP205 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 205kDa
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000060027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371954.2-3363s1c1
Sequence:CCGGGCCTCAATAGAGCTAAGGGTACTCGAGTACCCTTAGCTCTATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371954.2-5143s1c1
Sequence:CCGGGCCAGTGCTTAGGACTACTAACTCGAGTTAGTAGTCCTAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371954.2-927s1c1
Sequence:CCGGGCAACAATTCACTCTCGTCTTCTCGAGAAGACGAGAGTGAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_371954.2-2460s1c1
Sequence:CCGGGCTCTCAGTTTACTGGAAGAACTCGAGTTCTTCCAGTAAACTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371954
VALIDATED
NUP205 MISSION shRNA shRNA Plasmid DNA
nucleoporin 205kDa
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000060027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371954.2-3363s1c1
Sequence:CCGGGCCTCAATAGAGCTAAGGGTACTCGAGTACCCTTAGCTCTATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371954.2-5143s1c1
Sequence:CCGGGCCAGTGCTTAGGACTACTAACTCGAGTTAGTAGTCCTAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371954.2-927s1c1
Sequence:CCGGGCAACAATTCACTCTCGTCTTCTCGAGAAGACGAGAGTGAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_371954.2-2460s1c1
Sequence:CCGGGCTCTCAGTTTACTGGAAGAACTCGAGTTCTTCCAGTAAACTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371954
VALIDATED
NUP205 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 205kDa
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000060027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371954.2-3363s1c1
Sequence:CCGGGCCTCAATAGAGCTAAGGGTACTCGAGTACCCTTAGCTCTATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371954.2-5143s1c1
Sequence:CCGGGCCAGTGCTTAGGACTACTAACTCGAGTTAGTAGTCCTAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371954.2-927s1c1
Sequence:CCGGGCAACAATTCACTCTCGTCTTCTCGAGAAGACGAGAGTGAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_371954.2-2460s1c1
Sequence:CCGGGCTCTCAGTTTACTGGAAGAACTCGAGTTCTTCCAGTAAACTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027513
VALIDATED
NUP205 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 205kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027513.1-6046s21c1
Sequence:CCGGACTGACTCTCTTCCGTGGAAGCTCGAGCTTCCACGGAAGAGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027513.1-5732s21c1
Sequence:CCGGTGGCGCCATCTGGAGTATTATCTCGAGATAATACTCCAGATGGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027513.1-3200s21c1
Sequence:CCGGCTGTGCTACCAGGTGATATATCTCGAGATATATCACCTGGTAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027513.1-5864s21c1
Sequence:CCGGCAAGTGAACCAGCACGATATACTCGAGTATATCGTGCTGGTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027513.1-1523s21c1
Sequence:CCGGGACCTGTTGCCTCCAACTATTCTCGAGAATAGTTGGAGGCAACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027513
VALIDATED
NUP205 MISSION shRNA shRNA Plasmid DNA
nucleoporin 205kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027513.1-6046s21c1
Sequence:CCGGACTGACTCTCTTCCGTGGAAGCTCGAGCTTCCACGGAAGAGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027513.1-5732s21c1
Sequence:CCGGTGGCGCCATCTGGAGTATTATCTCGAGATAATACTCCAGATGGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027513.1-3200s21c1
Sequence:CCGGCTGTGCTACCAGGTGATATATCTCGAGATATATCACCTGGTAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027513.1-5864s21c1
Sequence:CCGGCAAGTGAACCAGCACGATATACTCGAGTATATCGTGCTGGTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027513.1-1523s21c1
Sequence:CCGGGACCTGTTGCCTCCAACTATTCTCGAGAATAGTTGGAGGCAACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027513
VALIDATED
NUP205 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 205kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027513.1-6046s21c1
Sequence:CCGGACTGACTCTCTTCCGTGGAAGCTCGAGCTTCCACGGAAGAGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027513.1-5732s21c1
Sequence:CCGGTGGCGCCATCTGGAGTATTATCTCGAGATAATACTCCAGATGGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027513.1-3200s21c1
Sequence:CCGGCTGTGCTACCAGGTGATATATCTCGAGATATATCACCTGGTAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027513.1-5864s21c1
Sequence:CCGGCAAGTGAACCAGCACGATATACTCGAGTATATCGTGCTGGTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027513.1-1523s21c1
Sequence:CCGGGACCTGTTGCCTCCAACTATTCTCGAGAATAGTTGGAGGCAACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015135
VALIDATED
NUP205 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 205kDa
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000333745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015135.2-5169s21c1
Sequence:CCGGGCCAGTGCTTAGGACTACTAACTCGAGTTAGTAGTCCTAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015135.2-2486s21c1
Sequence:CCGGGCTCTCAGTTTACTGGAAGAACTCGAGTTCTTCCAGTAAACTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015135.2-953s21c1
Sequence:CCGGGCAACAATTCACTCTCGTCTTCTCGAGAAGACGAGAGTGAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015135.2-6075s21c1
Sequence:CCGGCCGTGCTTATGCTCTTCTATGCTCGAGCATAGAAGAGCATAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015135
VALIDATED
NUP205 MISSION shRNA shRNA Plasmid DNA
nucleoporin 205kDa
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000333745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015135.2-5169s21c1
Sequence:CCGGGCCAGTGCTTAGGACTACTAACTCGAGTTAGTAGTCCTAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015135.2-2486s21c1
Sequence:CCGGGCTCTCAGTTTACTGGAAGAACTCGAGTTCTTCCAGTAAACTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015135.2-953s21c1
Sequence:CCGGGCAACAATTCACTCTCGTCTTCTCGAGAAGACGAGAGTGAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015135.2-6075s21c1
Sequence:CCGGCCGTGCTTATGCTCTTCTATGCTCGAGCATAGAAGAGCATAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015135
VALIDATED
NUP205 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 205kDa
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000333745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015135.2-5169s21c1
Sequence:CCGGGCCAGTGCTTAGGACTACTAACTCGAGTTAGTAGTCCTAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015135.2-2486s21c1
Sequence:CCGGGCTCTCAGTTTACTGGAAGAACTCGAGTTCTTCCAGTAAACTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015135.2-953s21c1
Sequence:CCGGGCAACAATTCACTCTCGTCTTCTCGAGAAGACGAGAGTGAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015135.2-6075s21c1
Sequence:CCGGCCGTGCTTATGCTCTTCTATGCTCGAGCATAGAAGAGCATAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks