EMAIL THIS PAGE TO A FRIEND

NUP43

nucleoporin 43kDa

Synonyms: bA350J20.1 p42
UniProtKB ID: Q8NFH3, Q9H8S0
Gene ID:
Human(348995) Summary: Bidirectional transport of macromolecules between the cytoplasm and nucleus occurs through nuclear pore complexes (NPCs) embedded in the nuclear envelope. NPCs are composed of subcomplexes, and NUP43 is part of one such subcomplex, Nup107-160 (Loiodice et al., 2004 [PubMed 15146057]
Mouse(69912) nucleoporin 43
Rat(683983) nucleoporin 43
sheep(101123306) nucleoporin 43kDa
naked mole-rat(101724478) nucleoporin 43kDa
Domestic Rabbit(100340965) nucleoporin 43kDa
domestic guinea pig(100712812) nucleoporin 43kDa
fruit fly(42209) Nucleoporin 43
Zebrafish(405828) nucleoporin 43
domestic cat(101099884) nucleoporin 43kDa
cow(520174) nucleoporin 43kDa
Horse(100064615) nucleoporin 43kDa
dog(484031) nucleoporin 43kDa
chicken(421628) nucleoporin 43kDa
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198887 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069971 MISSION® esiRNA esiRNA human NUP43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198887 Rosetta Predictions human pricing
NM_001128191 Rosetta Predictions rat pricing
NM_145706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372388 predicted 249
2 SASI_Hs01_00217506 predicted 1200
3 SASI_Hs01_00217507 predicted 558
4 SASI_Hs01_00217508 predicted 728
5 SASI_Hs01_00217511 predicted 784
6 SASI_Hs01_00217512 predicted 991
7 SASI_Hs02_00372389 predicted 224
8 SASI_Hs01_00217514 predicted 764
9 SASI_Hs02_00372390 predicted 1247
10 SASI_Hs02_00372391 predicted 304
11 SASI_Hs01_00217509 predicted 782
12 SASI_Hs01_00217510 predicted 567
13 SASI_Hs01_00217513 predicted 1170
14 SASI_Hs01_00217515 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255090 predicted 712
2 SASI_Rn02_00255091 predicted 456
3 SASI_Rn02_00255092 predicted 492
4 SASI_Rn02_00255093 predicted 689
5 SASI_Rn02_00255094 predicted 572
6 SASI_Rn02_00255095 predicted 362
7 SASI_Rn02_00255096 predicted 236
8 SASI_Rn02_00255097 predicted 512
9 SASI_Rn02_00255098 predicted 677
10 SASI_Rn02_00255099 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341243 predicted 798
2 SASI_Mm02_00341244 predicted 447
3 SASI_Mm02_00341245 predicted 279
4 SASI_Mm02_00341246 predicted 452
5 SASI_Mm02_00341247 predicted 779
6 SASI_Mm02_00341248 predicted 246
7 SASI_Mm02_00341249 predicted 667
8 SASI_Mm02_00341250 predicted 601
9 SASI_Mm02_00341251 predicted 767
10 SASI_Mm01_00144636 predicted 841
11 SASI_Mm01_00144629 predicted 1013
12 SASI_Mm01_00144630 predicted 1021
13 SASI_Mm01_00144631 predicted 1010
14 SASI_Mm01_00144632 predicted 904
15 SASI_Mm01_00144633 predicted 864
16 SASI_Mm01_00144634 predicted 1052
17 SASI_Mm01_00144635 predicted 870
18 SASI_Mm01_00144637 predicted 834
19 SASI_Mm01_00144638 predicted 959
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024647
VALIDATED
NUP43 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 43kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024647.4-928s1c1
Sequence:CCGGGCTTCCACAGATGTACCTGAACTCGAGTTCAGGTACATCTGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-1154s1c1
Sequence:CCGGGAACCGATGCAGAAGCAATTTCTCGAGAAATTGCTTCTGCATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-2155s1c1
Sequence:CCGGGCATAGCTGAAAGTTGCCAAACTCGAGTTTGGCAACTTTCAGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-1071s1c1
Sequence:CCGGCCGAATTGAAATCACAAGCTTCTCGAGAAGCTTGTGATTTCAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-544s1c1
Sequence:CCGGGCTGTAAGAACCATAGACAATCTCGAGATTGTCTATGGTTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-247s1c1
Sequence:CCGGGACCATCAGTTATTGTGTGATCTCGAGATCACACAATAACTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-768s1c1
Sequence:CCGGCCAAGATGGAATGTTGAGTATCTCGAGATACTCAACATTCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-767s1c1
Sequence:CCGGGCCAAGATGGAATGTTGAGTACTCGAGTACTCAACATTCCATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-191s1c1
Sequence:CCGGCACTGTGGTCTATTGGAGATTCTCGAGAATCTCCAATAGACCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-565s1c1
Sequence:CCGGGCAGATAGTAGTACACTCCATCTCGAGATGGAGTGTACTACTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-154s1c1
Sequence:CCGGGCTACAGGATCTTGGGACAATCTCGAGATTGTCCCAAGATCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024647
VALIDATED
NUP43 MISSION shRNA shRNA Plasmid DNA
nucleoporin 43kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024647.4-928s1c1
Sequence:CCGGGCTTCCACAGATGTACCTGAACTCGAGTTCAGGTACATCTGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-1154s1c1
Sequence:CCGGGAACCGATGCAGAAGCAATTTCTCGAGAAATTGCTTCTGCATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-2155s1c1
Sequence:CCGGGCATAGCTGAAAGTTGCCAAACTCGAGTTTGGCAACTTTCAGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-1071s1c1
Sequence:CCGGCCGAATTGAAATCACAAGCTTCTCGAGAAGCTTGTGATTTCAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-544s1c1
Sequence:CCGGGCTGTAAGAACCATAGACAATCTCGAGATTGTCTATGGTTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-247s1c1
Sequence:CCGGGACCATCAGTTATTGTGTGATCTCGAGATCACACAATAACTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-768s1c1
Sequence:CCGGCCAAGATGGAATGTTGAGTATCTCGAGATACTCAACATTCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-767s1c1
Sequence:CCGGGCCAAGATGGAATGTTGAGTACTCGAGTACTCAACATTCCATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-191s1c1
Sequence:CCGGCACTGTGGTCTATTGGAGATTCTCGAGAATCTCCAATAGACCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-565s1c1
Sequence:CCGGGCAGATAGTAGTACACTCCATCTCGAGATGGAGTGTACTACTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-154s1c1
Sequence:CCGGGCTACAGGATCTTGGGACAATCTCGAGATTGTCCCAAGATCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024647
VALIDATED
NUP43 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 43kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024647.4-928s1c1
Sequence:CCGGGCTTCCACAGATGTACCTGAACTCGAGTTCAGGTACATCTGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-1154s1c1
Sequence:CCGGGAACCGATGCAGAAGCAATTTCTCGAGAAATTGCTTCTGCATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-2155s1c1
Sequence:CCGGGCATAGCTGAAAGTTGCCAAACTCGAGTTTGGCAACTTTCAGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-1071s1c1
Sequence:CCGGCCGAATTGAAATCACAAGCTTCTCGAGAAGCTTGTGATTTCAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-544s1c1
Sequence:CCGGGCTGTAAGAACCATAGACAATCTCGAGATTGTCTATGGTTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-247s1c1
Sequence:CCGGGACCATCAGTTATTGTGTGATCTCGAGATCACACAATAACTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-768s1c1
Sequence:CCGGCCAAGATGGAATGTTGAGTATCTCGAGATACTCAACATTCCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-767s1c1
Sequence:CCGGGCCAAGATGGAATGTTGAGTACTCGAGTACTCAACATTCCATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024647.4-191s1c1
Sequence:CCGGCACTGTGGTCTATTGGAGATTCTCGAGAATCTCCAATAGACCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-565s1c1
Sequence:CCGGGCAGATAGTAGTACACTCCATCTCGAGATGGAGTGTACTACTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024647.4-154s1c1
Sequence:CCGGGCTACAGGATCTTGGGACAATCTCGAGATTGTCCCAAGATCCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145706
VALIDATED
NUP43 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 43kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145706.1-1050s1c1
Sequence:CCGGCTGCCAAAGACCGAATTGAAACTCGAGTTTCAATTCGGTCTTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145706.1-975s1c1
Sequence:CCGGCTTTCCTGTCACATAGCTTAACTCGAGTTAAGCTATGTGACAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145706.1-1143s1c1
Sequence:CCGGGAACTGATGCAGAAGCCATTTCTCGAGAAATGGCTTCTGCATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-252s21c1
Sequence:CCGGATCAGTTACTGTGCGATATTACTCGAGTAATATCGCACAGTAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-499s21c1
Sequence:CCGGTGGAGAGGATGGCCGAATAAACTCGAGTTTATTCGGCCATCCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-771s21c1
Sequence:CCGGAGGATGGAATGTTGAGTATTTCTCGAGAAATACTCAACATTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-186s21c1
Sequence:CCGGGCGTTTCACTGTGGTCTATTGCTCGAGCAATAGACCACAGTGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-546s21c1
Sequence:CCGGCTGTCAGAACTATAGATAATGCTCGAGCATTATCTATAGTTCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145706
VALIDATED
NUP43 MISSION shRNA shRNA Plasmid DNA
nucleoporin 43kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145706.1-1050s1c1
Sequence:CCGGCTGCCAAAGACCGAATTGAAACTCGAGTTTCAATTCGGTCTTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145706.1-975s1c1
Sequence:CCGGCTTTCCTGTCACATAGCTTAACTCGAGTTAAGCTATGTGACAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145706.1-1143s1c1
Sequence:CCGGGAACTGATGCAGAAGCCATTTCTCGAGAAATGGCTTCTGCATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-252s21c1
Sequence:CCGGATCAGTTACTGTGCGATATTACTCGAGTAATATCGCACAGTAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-499s21c1
Sequence:CCGGTGGAGAGGATGGCCGAATAAACTCGAGTTTATTCGGCCATCCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-771s21c1
Sequence:CCGGAGGATGGAATGTTGAGTATTTCTCGAGAAATACTCAACATTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-186s21c1
Sequence:CCGGGCGTTTCACTGTGGTCTATTGCTCGAGCAATAGACCACAGTGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-546s21c1
Sequence:CCGGCTGTCAGAACTATAGATAATGCTCGAGCATTATCTATAGTTCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145706
VALIDATED
NUP43 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 43kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145706.1-1050s1c1
Sequence:CCGGCTGCCAAAGACCGAATTGAAACTCGAGTTTCAATTCGGTCTTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145706.1-975s1c1
Sequence:CCGGCTTTCCTGTCACATAGCTTAACTCGAGTTAAGCTATGTGACAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145706.1-1143s1c1
Sequence:CCGGGAACTGATGCAGAAGCCATTTCTCGAGAAATGGCTTCTGCATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-252s21c1
Sequence:CCGGATCAGTTACTGTGCGATATTACTCGAGTAATATCGCACAGTAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-499s21c1
Sequence:CCGGTGGAGAGGATGGCCGAATAAACTCGAGTTTATTCGGCCATCCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-771s21c1
Sequence:CCGGAGGATGGAATGTTGAGTATTTCTCGAGAAATACTCAACATTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-186s21c1
Sequence:CCGGGCGTTTCACTGTGGTCTATTGCTCGAGCAATAGACCACAGTGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145706.2-546s21c1
Sequence:CCGGCTGTCAGAACTATAGATAATGCTCGAGCATTATCTATAGTTCTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198887
VALIDATED
NUP43 MISSION shRNA Bacterial Glycerol Stock
nucleoporin 43kDa
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000297965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198887.1-247s21c1
Sequence:CCGGGACCATCAGTTATTGTGTGATCTCGAGATCACACAATAACTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198887.1-1154s21c1
Sequence:CCGGGAACCGATGCAGAAGCAATTTCTCGAGAAATTGCTTCTGCATCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_198887.1-565s21c1
Sequence:CCGGGCAGATAGTAGTACACTCCATCTCGAGATGGAGTGTACTACTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_198887.1-1071s21c1
Sequence:CCGGCCGAATTGAAATCACAAGCTTCTCGAGAAGCTTGTGATTTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198887
VALIDATED
NUP43 MISSION shRNA shRNA Plasmid DNA
nucleoporin 43kDa
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000297965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198887.1-247s21c1
Sequence:CCGGGACCATCAGTTATTGTGTGATCTCGAGATCACACAATAACTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198887.1-1154s21c1
Sequence:CCGGGAACCGATGCAGAAGCAATTTCTCGAGAAATTGCTTCTGCATCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_198887.1-565s21c1
Sequence:CCGGGCAGATAGTAGTACACTCCATCTCGAGATGGAGTGTACTACTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_198887.1-1071s21c1
Sequence:CCGGCCGAATTGAAATCACAAGCTTCTCGAGAAGCTTGTGATTTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198887
VALIDATED
NUP43 MISSION shRNA Lentiviral Transduction Particles
nucleoporin 43kDa
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000297965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198887.1-247s21c1
Sequence:CCGGGACCATCAGTTATTGTGTGATCTCGAGATCACACAATAACTGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198887.1-1154s21c1
Sequence:CCGGGAACCGATGCAGAAGCAATTTCTCGAGAAATTGCTTCTGCATCGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_198887.1-565s21c1
Sequence:CCGGGCAGATAGTAGTACACTCCATCTCGAGATGGAGTGTACTACTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_198887.1-1071s21c1
Sequence:CCGGCCGAATTGAAATCACAAGCTTCTCGAGAAGCTTGTGATTTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks