EMAIL THIS PAGE TO A FRIEND

NUPR1L

nuclear protein, transcriptional regulator, 1-like

UniProtKB ID: A6NF83
Gene ID:
Mouse(69034) nuclear protein transcriptional regulator 1 like
Rat(360799) nuclear protein, transcriptional regulator, 1-like
cow(614047) nuclear protein, transcriptional regulator, 1-like
dog(606880) nuclear protein, transcriptional regulator, 1-like
sheep(101109761) nuclear protein, transcriptional regulator, 1-like
domestic guinea pig(100720410) nuclear protein, transcriptional regulator, 1-like
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145712 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714433 Rosetta Predictions human pricing
XM_001714466 Rosetta Predictions human pricing
XM_001715703 Rosetta Predictions human pricing
NM_001134570 Rosetta Predictions rat pricing
NM_026916 Rosetta Predictions mouse pricing
XR_035134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00397077 predicted 530
2 SASI_Hs02_00397078 predicted 318
3 SASI_Hs02_00397079 predicted 257
4 SASI_Hs02_00397080 predicted 527
5 SASI_Hs02_00397081 predicted 325
6 SASI_Hs02_00397082 predicted 247
7 SASI_Hs02_00397083 predicted 279
8 SASI_Hs02_00397084 predicted 279
9 SASI_Hs02_00397085 predicted 217
10 SASI_Hs02_00397086 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00397294 predicted 544
2 SASI_Hs02_00397295 predicted 337
3 SASI_Hs02_00397296 predicted 551
4 SASI_Hs02_00397297 predicted 346
5 SASI_Hs02_00397298 predicted 306
6 SASI_Hs02_00397299 predicted 297
7 SASI_Hs02_00397300 predicted 261
8 SASI_Hs02_00397301 predicted 270
9 SASI_Hs02_00397302 predicted 243
10 SASI_Hs02_00397303 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00405535 predicted 526
2 SASI_Hs02_00405536 predicted 318
3 SASI_Hs02_00405537 predicted 259
4 SASI_Hs02_00405538 predicted 533
5 SASI_Hs02_00405539 predicted 324
6 SASI_Hs02_00405540 predicted 245
7 SASI_Hs02_00405541 predicted 281
8 SASI_Hs02_00405542 predicted 281
9 SASI_Hs02_00405543 predicted 221
10 SASI_Hs02_00405544 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257189 predicted 223
2 SASI_Rn02_00257190 predicted 305
3 SASI_Rn02_00257191 predicted 299
4 SASI_Rn02_00257192 predicted 291
5 SASI_Rn02_00257193 predicted 234
6 SASI_Rn02_00257194 predicted 268
7 SASI_Rn02_00257195 predicted 293
8 SASI_Rn02_00257196 predicted 260
9 SASI_Rn02_00257197 predicted 263
10 SASI_Rn02_00257198 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083055 predicted 246
2 SASI_Mm01_00083056 predicted 358
3 SASI_Mm01_00083057 predicted 352
4 SASI_Mm01_00083058 predicted 198
5 SASI_Mm01_00083059 predicted 329
6 SASI_Mm01_00083060 predicted 253
7 SASI_Mm01_00083061 predicted 293
8 SASI_Mm01_00083062 predicted 251
9 SASI_Mm01_00083063 predicted 204
10 SASI_Mm01_00083064 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00480166 predicted 245
2 SASI_Mm02_00480167 predicted 341
3 SASI_Mm02_00480168 predicted 196
4 SASI_Mm02_00480169 predicted 312
5 SASI_Mm02_00480170 predicted 309
6 SASI_Mm02_00480171 predicted 327
7 SASI_Mm02_00480172 predicted 249
8 SASI_Mm02_00480173 predicted 287
9 SASI_Mm02_00480174 predicted 241
10 SASI_Mm02_00480175 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026916
NUPR1L MISSION shRNA Bacterial Glycerol Stock
nuclear protein, transcriptional regulator, 1-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026916.1-127s1c1
Sequence:CCGGGTACGACTGCCTGGATTACTACTCGAGTAGTAATCCAGGCAGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-390s1c1
Sequence:CCGGCCTGCCTGGGCATTATTGAAACTCGAGTTTCAATAATGCCCAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-137s1c1
Sequence:CCGGCTGGATTACTACTACCTGCGTCTCGAGACGCAGGTAGTAGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-130s1c1
Sequence:CCGGCGACTGCCTGGATTACTACTACTCGAGTAGTAGTAATCCAGGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-393s1c1
Sequence:CCGGGCCTGGGCATTATTGAAACCTCTCGAGAGGTTTCAATAATGCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026916.3-232s21c1
Sequence:CCGGGCAGCAGCTACGCACCAACTACTCGAGTAGTTGGTGCGTAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026916.3-460s21c1
Sequence:CCGGTTTCCAGCTGTAACCAAGATCCTCGAGGATCTTGGTTACAGCTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026916.3-399s21c1
Sequence:CCGGGATCTTGAGTTGGAGTCCTGCCTCGAGGCAGGACTCCAACTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026916
NUPR1L MISSION shRNA shRNA Plasmid DNA
nuclear protein, transcriptional regulator, 1-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026916.1-127s1c1
Sequence:CCGGGTACGACTGCCTGGATTACTACTCGAGTAGTAATCCAGGCAGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-390s1c1
Sequence:CCGGCCTGCCTGGGCATTATTGAAACTCGAGTTTCAATAATGCCCAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-137s1c1
Sequence:CCGGCTGGATTACTACTACCTGCGTCTCGAGACGCAGGTAGTAGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-130s1c1
Sequence:CCGGCGACTGCCTGGATTACTACTACTCGAGTAGTAGTAATCCAGGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-393s1c1
Sequence:CCGGGCCTGGGCATTATTGAAACCTCTCGAGAGGTTTCAATAATGCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026916.3-232s21c1
Sequence:CCGGGCAGCAGCTACGCACCAACTACTCGAGTAGTTGGTGCGTAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026916.3-460s21c1
Sequence:CCGGTTTCCAGCTGTAACCAAGATCCTCGAGGATCTTGGTTACAGCTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026916.3-399s21c1
Sequence:CCGGGATCTTGAGTTGGAGTCCTGCCTCGAGGCAGGACTCCAACTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026916
NUPR1L MISSION shRNA Lentiviral Transduction Particles
nuclear protein, transcriptional regulator, 1-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026916.1-127s1c1
Sequence:CCGGGTACGACTGCCTGGATTACTACTCGAGTAGTAATCCAGGCAGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-390s1c1
Sequence:CCGGCCTGCCTGGGCATTATTGAAACTCGAGTTTCAATAATGCCCAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-137s1c1
Sequence:CCGGCTGGATTACTACTACCTGCGTCTCGAGACGCAGGTAGTAGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-130s1c1
Sequence:CCGGCGACTGCCTGGATTACTACTACTCGAGTAGTAGTAATCCAGGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026916.1-393s1c1
Sequence:CCGGGCCTGGGCATTATTGAAACCTCTCGAGAGGTTTCAATAATGCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026916.3-232s21c1
Sequence:CCGGGCAGCAGCTACGCACCAACTACTCGAGTAGTTGGTGCGTAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026916.3-460s21c1
Sequence:CCGGTTTCCAGCTGTAACCAAGATCCTCGAGGATCTTGGTTACAGCTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026916.3-399s21c1
Sequence:CCGGGATCTTGAGTTGGAGTCCTGCCTCGAGGCAGGACTCCAACTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145712
NUPR1L MISSION shRNA Bacterial Glycerol Stock
nuclear protein, transcriptional regulator, 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-390s21c1
Sequence:CCGGGAAGGACCTGTTCGAAGTATTCTCGAGAATACTTCGAACAGGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-475s21c1
Sequence:CCGGTTTCGCTGTCACTTAAGTTTACTCGAGTAAACTTAAGTGACAGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-413s21c1
Sequence:CCGGCTGTAACTCCAACTGTAACTTCTCGAGAAGTTACAGTTGGAGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145712.1-170s21c1
Sequence:CCGGCGACTGCCTGGACTACTACTACTCGAGTAGTAGTAGTCCAGGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-442s21c1
Sequence:CCGGGGAGGAGAGAATCCATGTTTGCTCGAGCAAACATGGATTCTCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145712
NUPR1L MISSION shRNA shRNA Plasmid DNA
nuclear protein, transcriptional regulator, 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-390s21c1
Sequence:CCGGGAAGGACCTGTTCGAAGTATTCTCGAGAATACTTCGAACAGGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-475s21c1
Sequence:CCGGTTTCGCTGTCACTTAAGTTTACTCGAGTAAACTTAAGTGACAGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-413s21c1
Sequence:CCGGCTGTAACTCCAACTGTAACTTCTCGAGAAGTTACAGTTGGAGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145712.1-170s21c1
Sequence:CCGGCGACTGCCTGGACTACTACTACTCGAGTAGTAGTAGTCCAGGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-442s21c1
Sequence:CCGGGGAGGAGAGAATCCATGTTTGCTCGAGCAAACATGGATTCTCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145712
NUPR1L MISSION shRNA Lentiviral Transduction Particles
nuclear protein, transcriptional regulator, 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-390s21c1
Sequence:CCGGGAAGGACCTGTTCGAAGTATTCTCGAGAATACTTCGAACAGGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-475s21c1
Sequence:CCGGTTTCGCTGTCACTTAAGTTTACTCGAGTAAACTTAAGTGACAGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-413s21c1
Sequence:CCGGCTGTAACTCCAACTGTAACTTCTCGAGAAGTTACAGTTGGAGTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145712.1-170s21c1
Sequence:CCGGCGACTGCCTGGACTACTACTACTCGAGTAGTAGTAGTCCAGGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145712.1-442s21c1
Sequence:CCGGGGAGGAGAGAATCCATGTTTGCTCGAGCAAACATGGATTCTCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks