EMAIL THIS PAGE TO A FRIEND

NUSAP1

nucleolar and spindle associated protein 1

Synonyms: ANKT BM037 LNP NUSAP PRO0310p1 Q0310 SAPL
Gene ID:
Human(51203) Summary: NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]
Mouse(108907) nucleolar and spindle associated protein 1
Rat(311336) nucleolar and spindle associated protein 1
Zebrafish(567446) nucleolar and spindle associated protein 1
chicken(423213) nucleolar and spindle associated protein 1
domestic cat(101085470) nucleolar and spindle associated protein 1
Horse(100071174) nucleolar and spindle associated protein 1
cow(616028) nucleolar and spindle associated protein 1
dog(475154) nucleolar and spindle associated protein 1
sheep(101112734) nucleolar and spindle associated protein 1
naked mole-rat(101726593) nucleolar and spindle associated protein 1
domestic guinea pig(100732320) nucleolar and spindle associated protein 1
Gene Class: Cytoskeleton
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078041 MISSION® esiRNA esiRNA targeting mouse Nusap1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016359 Rosetta Predictions human pricing
NM_018454 Rosetta Predictions human pricing
NM_001107762 Rosetta Predictions rat pricing
NM_001042652 Rosetta Predictions mouse pricing
NM_133851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171169 predicted 1188
2 SASI_Hs01_00171170 predicted 956
3 SASI_Hs01_00171172 predicted 1711
4 SASI_Hs01_00171173 predicted 1043
5 SASI_Hs01_00171174 predicted 956
6 SASI_Hs01_00171175 predicted 966
7 SASI_Hs01_00171176 predicted 1132
8 SASI_Hs01_00171177 predicted 1790
9 SASI_Hs01_00171178 predicted 1142
10 SASI_Hs02_00349334 predicted 1741
11 SASI_Hs01_00171171 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120642 predicted 384
2 SASI_Hs01_00120643 predicted 1188
3 SASI_Hs01_00120644 predicted 497
4 SASI_Hs01_00120645 predicted 456
5 SASI_Hs01_00120646 predicted 955
6 SASI_Hs01_00120647 predicted 1712
7 SASI_Hs01_00120648 predicted 953
8 SASI_Hs01_00120649 predicted 274
9 SASI_Hs01_00120650 predicted 284
10 SASI_Hs02_00352000 predicted 514
11 SASI_Hs01_00120651 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232015 predicted 890
2 SASI_Rn02_00232016 predicted 1140
3 SASI_Rn02_00232017 predicted 1057
4 SASI_Rn02_00232018 predicted 1229
5 SASI_Rn02_00232019 predicted 889
6 SASI_Rn02_00232020 predicted 1171
7 SASI_Rn02_00232021 predicted 898
8 SASI_Rn02_00232022 predicted 392
9 SASI_Rn02_00232023 predicted 688
10 SASI_Rn02_00232024 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290845 predicted 1351
2 SASI_Mm02_00290846 predicted 1229
3 SASI_Mm02_00290847 predicted 1602
4 SASI_Mm02_00290848 predicted 683
5 SASI_Mm02_00290849 predicted 1593
6 SASI_Mm02_00290850 predicted 1224
7 SASI_Mm02_00290851 predicted 1236
8 SASI_Mm02_00290852 predicted 1417
9 SASI_Mm02_00290853 predicted 683
10 SASI_Mm02_00290854 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020477 predicted 1452
2 SASI_Mm01_00020479 predicted 1333
3 SASI_Mm02_00338897 predicted 1704
4 SASI_Mm01_00020480 predicted 684
5 SASI_Mm02_00338898 predicted 1689
6 SASI_Mm02_00338899 predicted 1329
7 SASI_Mm02_00338900 predicted 1327
8 SASI_Mm01_00020483 predicted 1511
9 SASI_Mm02_00338901 predicted 677
10 SASI_Mm02_00338902 predicted 672
11 SASI_Mm01_00020476 predicted 1122
12 SASI_Mm01_00020478 predicted 1016
13 SASI_Mm01_00020481 predicted 1530
14 SASI_Mm01_00020482 predicted 1155
15 SASI_Mm01_00020484 predicted 1083
16 SASI_Mm01_00020485 predicted 1607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018454
VALIDATED
NUSAP1 MISSION shRNA Bacterial Glycerol Stock
nucleolar and spindle associated protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-415s1c1
Sequence:CCGGGAGCACCAAGAAGCTGAGAATCTCGAGATTCTCAGCTTCTTGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018454.4-652s1c1
Sequence:CCGGGAACTGAAGCAGCCCATCAATCTCGAGATTGATGGGCTGCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018454.4-208s1c1
Sequence:CCGGCAGATCAGCAACCAGGAAGAACTCGAGTTCTTCCTGGTTGCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-873s1c1
Sequence:CCGGGCATAAGCGTTCACTGACCAACTCGAGTTGGTCAGTGAACGCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018454.4-198s1c1
Sequence:CCGGGACTGAGATACAGATCAGCAACTCGAGTTGCTGATCTGTATCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-90s1c1
Sequence:CCGGGAGGGCAACCAAGTTGTTAAACTCGAGTTTAACAACTTGGTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-1108s1c1
Sequence:CCGGGAACCACACAAAGGAAAGCTACTCGAGTAGCTTTCCTTTGTGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-443s1c1
Sequence:CCGGCCTCAGGTAACAGAGATTCAACTCGAGTTGAATCTCTGTTACCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-1103s21c1
Sequence:CCGGGCATAAGCGTTCACTGACCAACTCGAGTTGGTCAGTGAACGCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-1338s21c1
Sequence:CCGGGAACCACACAAAGGAAAGCTACTCGAGTAGCTTTCCTTTGTGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-645s21c1
Sequence:CCGGGAGCACCAAGAAGCTGAGAATCTCGAGATTCTCAGCTTCTTGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-673s21c1
Sequence:CCGGCCTCAGGTAACAGAGATTCAACTCGAGTTGAATCTCTGTTACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018454
VALIDATED
NUSAP1 MISSION shRNA shRNA Plasmid DNA
nucleolar and spindle associated protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-415s1c1
Sequence:CCGGGAGCACCAAGAAGCTGAGAATCTCGAGATTCTCAGCTTCTTGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018454.4-652s1c1
Sequence:CCGGGAACTGAAGCAGCCCATCAATCTCGAGATTGATGGGCTGCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018454.4-208s1c1
Sequence:CCGGCAGATCAGCAACCAGGAAGAACTCGAGTTCTTCCTGGTTGCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-873s1c1
Sequence:CCGGGCATAAGCGTTCACTGACCAACTCGAGTTGGTCAGTGAACGCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018454.4-198s1c1
Sequence:CCGGGACTGAGATACAGATCAGCAACTCGAGTTGCTGATCTGTATCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-90s1c1
Sequence:CCGGGAGGGCAACCAAGTTGTTAAACTCGAGTTTAACAACTTGGTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-1108s1c1
Sequence:CCGGGAACCACACAAAGGAAAGCTACTCGAGTAGCTTTCCTTTGTGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-443s1c1
Sequence:CCGGCCTCAGGTAACAGAGATTCAACTCGAGTTGAATCTCTGTTACCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-1103s21c1
Sequence:CCGGGCATAAGCGTTCACTGACCAACTCGAGTTGGTCAGTGAACGCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-1338s21c1
Sequence:CCGGGAACCACACAAAGGAAAGCTACTCGAGTAGCTTTCCTTTGTGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-645s21c1
Sequence:CCGGGAGCACCAAGAAGCTGAGAATCTCGAGATTCTCAGCTTCTTGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-673s21c1
Sequence:CCGGCCTCAGGTAACAGAGATTCAACTCGAGTTGAATCTCTGTTACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018454
VALIDATED
NUSAP1 MISSION shRNA Lentiviral Transduction Particles
nucleolar and spindle associated protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-415s1c1
Sequence:CCGGGAGCACCAAGAAGCTGAGAATCTCGAGATTCTCAGCTTCTTGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018454.4-652s1c1
Sequence:CCGGGAACTGAAGCAGCCCATCAATCTCGAGATTGATGGGCTGCTTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018454.4-208s1c1
Sequence:CCGGCAGATCAGCAACCAGGAAGAACTCGAGTTCTTCCTGGTTGCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-873s1c1
Sequence:CCGGGCATAAGCGTTCACTGACCAACTCGAGTTGGTCAGTGAACGCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018454.4-198s1c1
Sequence:CCGGGACTGAGATACAGATCAGCAACTCGAGTTGCTGATCTGTATCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-90s1c1
Sequence:CCGGGAGGGCAACCAAGTTGTTAAACTCGAGTTTAACAACTTGGTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-1108s1c1
Sequence:CCGGGAACCACACAAAGGAAAGCTACTCGAGTAGCTTTCCTTTGTGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018454.4-443s1c1
Sequence:CCGGCCTCAGGTAACAGAGATTCAACTCGAGTTGAATCTCTGTTACCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-1103s21c1
Sequence:CCGGGCATAAGCGTTCACTGACCAACTCGAGTTGGTCAGTGAACGCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-1338s21c1
Sequence:CCGGGAACCACACAAAGGAAAGCTACTCGAGTAGCTTTCCTTTGTGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-645s21c1
Sequence:CCGGGAGCACCAAGAAGCTGAGAATCTCGAGATTCTCAGCTTCTTGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018454.6-673s21c1
Sequence:CCGGCCTCAGGTAACAGAGATTCAACTCGAGTTGAATCTCTGTTACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133851
VALIDATED
NUSAP1 MISSION shRNA Bacterial Glycerol Stock
nucleolar and spindle associated protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133851.1-1281s1c1
Sequence:CCGGCGATGGAAGAGACAAGAGCAACTCGAGTTGCTCTTGTCTCTTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133851.1-1490s1c1
Sequence:CCGGCTGTGCTATATCTGAGAATATCTCGAGATATTCTCAGATATAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133851.1-1023s1c1
Sequence:CCGGGCCACTGAAAGGACTTCTATTCTCGAGAATAGAAGTCCTTTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133851.1-2003s1c1
Sequence:CCGGGCTGTAAGAATTACTGTCATTCTCGAGAATGACAGTAATTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1700s21c1
Sequence:CCGGCGATGGAAGAGACAAGAGCAACTCGAGTTGCTCTTGTCTCTTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1442s21c1
Sequence:CCGGGCCACTGAAAGGACTTCTATTCTCGAGAATAGAAGTCCTTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1909s21c1
Sequence:CCGGCTGTGCTATATCTGAGAATATCTCGAGATATTCTCAGATATAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1514s21c1
Sequence:CCGGTCTAGTAAGAAGCCAGTATTTCTCGAGAAATACTGGCTTCTTACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1118s21c1
Sequence:CCGGATGGAATCCATTGATGAATATCTCGAGATATTCATCAATGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133851
VALIDATED
NUSAP1 MISSION shRNA shRNA Plasmid DNA
nucleolar and spindle associated protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133851.1-1281s1c1
Sequence:CCGGCGATGGAAGAGACAAGAGCAACTCGAGTTGCTCTTGTCTCTTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133851.1-1490s1c1
Sequence:CCGGCTGTGCTATATCTGAGAATATCTCGAGATATTCTCAGATATAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133851.1-1023s1c1
Sequence:CCGGGCCACTGAAAGGACTTCTATTCTCGAGAATAGAAGTCCTTTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133851.1-2003s1c1
Sequence:CCGGGCTGTAAGAATTACTGTCATTCTCGAGAATGACAGTAATTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1700s21c1
Sequence:CCGGCGATGGAAGAGACAAGAGCAACTCGAGTTGCTCTTGTCTCTTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1442s21c1
Sequence:CCGGGCCACTGAAAGGACTTCTATTCTCGAGAATAGAAGTCCTTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1909s21c1
Sequence:CCGGCTGTGCTATATCTGAGAATATCTCGAGATATTCTCAGATATAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1514s21c1
Sequence:CCGGTCTAGTAAGAAGCCAGTATTTCTCGAGAAATACTGGCTTCTTACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1118s21c1
Sequence:CCGGATGGAATCCATTGATGAATATCTCGAGATATTCATCAATGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133851
VALIDATED
NUSAP1 MISSION shRNA Lentiviral Transduction Particles
nucleolar and spindle associated protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133851.1-1281s1c1
Sequence:CCGGCGATGGAAGAGACAAGAGCAACTCGAGTTGCTCTTGTCTCTTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133851.1-1490s1c1
Sequence:CCGGCTGTGCTATATCTGAGAATATCTCGAGATATTCTCAGATATAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133851.1-1023s1c1
Sequence:CCGGGCCACTGAAAGGACTTCTATTCTCGAGAATAGAAGTCCTTTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133851.1-2003s1c1
Sequence:CCGGGCTGTAAGAATTACTGTCATTCTCGAGAATGACAGTAATTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1700s21c1
Sequence:CCGGCGATGGAAGAGACAAGAGCAACTCGAGTTGCTCTTGTCTCTTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1442s21c1
Sequence:CCGGGCCACTGAAAGGACTTCTATTCTCGAGAATAGAAGTCCTTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1909s21c1
Sequence:CCGGCTGTGCTATATCTGAGAATATCTCGAGATATTCTCAGATATAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1514s21c1
Sequence:CCGGTCTAGTAAGAAGCCAGTATTTCTCGAGAAATACTGGCTTCTTACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133851.3-1118s21c1
Sequence:CCGGATGGAATCCATTGATGAATATCTCGAGATATTCATCAATGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks