EMAIL THIS PAGE TO A FRIEND

NXF1

nuclear RNA export factor 1

Synonyms: MEX67 TAP
UniProtKB ID: Q9UBU9, B4E269, Q99799, Q9UQL2
Gene ID:
Human(10482) Summary: This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(53319) nuclear RNA export factor 1
Rat(59087) nuclear RNA export factor 1
Zebrafish(323865) nuclear RNA export factor 1
chicken(769691) nuclear RNA export factor 1
dog(483780) nuclear RNA export factor 1
Horse(100049009) nuclear RNA export factor 1
cow(512136) nuclear RNA export factor 1
domestic cat(101092292) nuclear RNA export factor 1
domestic guinea pig(100728879) nuclear RNA export factor 1
naked mole-rat(101699957) nuclear RNA export factor 1
Domestic Rabbit(100347351) nuclear RNA export factor 1
sheep(101115327) nuclear RNA export factor 1
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40638 Anti-NXF1 antibody produced in rabbit affinity isolated antibody canine, mouse, rat, human, guinea pig, horse, bovine, rabbit
western blot pricing
AV40639 Anti-NXF1 antibody produced in rabbit IgG fraction of antiserum human, rat, guinea pig, bovine, canine, mouse
immunohistochemistry, western blot pricing
HPA061593 Anti-NXF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
T1076 Monoclonal Anti-TAP antibody produced in mouse ~1.5 mg/mL, clone 53H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081491 Rosetta Predictions human pricing
NM_006362 Rosetta Predictions human pricing
NM_021579 Rosetta Predictions rat pricing
NM_016813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316373 predicted 770
2 SASI_Hs02_00316374 predicted 584
3 SASI_Hs02_00316375 predicted 385
4 SASI_Hs02_00316376 predicted 929
5 SASI_Hs02_00316377 predicted 639
6 SASI_Hs02_00316378 predicted 688
7 SASI_Hs02_00316379 predicted 475
8 SASI_Hs02_00316380 predicted 748
9 SASI_Hs02_00316381 predicted 299
10 SASI_Hs02_00316382 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040807 predicted 775
2 SASI_Hs01_00040808 predicted 386
3 SASI_Hs01_00040809 predicted 1504
4 SASI_Hs01_00040810 predicted 1694
5 SASI_Hs01_00040811 predicted 641
6 SASI_Hs01_00040813 predicted 1982
7 SASI_Hs02_00341420 predicted 1831
8 SASI_Hs01_00040814 predicted 682
9 SASI_Hs01_00040815 predicted 745
10 SASI_Hs02_00341421 predicted 1679
11 SASI_Hs01_00040812 predicted 951
12 SASI_Hs01_00040816 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065390 predicted 778
2 SASI_Rn01_00065391 predicted 1623
3 SASI_Rn01_00065392 predicted 317
4 SASI_Rn01_00065393 predicted 1486
5 SASI_Rn01_00065394 predicted 1493
6 SASI_Rn01_00065395 predicted 572
7 SASI_Rn01_00065396 predicted 1088
8 SASI_Rn02_00262605 predicted 886
9 SASI_Rn01_00065397 predicted 291
10 SASI_Rn01_00065398 predicted 874
11 SASI_Rn01_00065399 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037514 predicted 1955
2 SASI_Mm02_00323610 predicted 671
3 SASI_Mm01_00037515 predicted 964
4 SASI_Mm01_00037516 predicted 617
5 SASI_Mm01_00037517 predicted 1436
6 SASI_Mm01_00037518 predicted 376
7 SASI_Mm01_00037520 predicted 1147
8 SASI_Mm02_00323611 predicted 1896
9 SASI_Mm01_00037521 predicted 845
10 SASI_Mm01_00037522 predicted 720
11 SASI_Mm01_00037519 predicted 857
12 SASI_Mm01_00037523 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006362
VALIDATED
NXF1 MISSION shRNA Bacterial Glycerol Stock
nuclear RNA export factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-1310s21c1
Sequence:CCGGCAACAGTACTATGCAATTTACCTCGAGGTAAATTGCATAGTACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-168s21c1
Sequence:CCGGACGATGATGAACGCGTTAATTCTCGAGAATTAACGCGTTCATCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006362.4-2162s21c1
Sequence:CCGGTCAGAAGATTGAGCCTCACTGCTCGAGCAGTGAGGCTCAATCTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-1422s21c1
Sequence:CCGGGAAGCAGCTTAGCCGAGTATTCTCGAGAATACTCGGCTAAGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-648s21c1
Sequence:CCGGCATTGAAGGCTGTCAACTATACTCGAGTATAGTTGACAGCCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006362.3-1741s1c1
Sequence:CCGGCCAGTTCTGAAGAGATCCAAACTCGAGTTTGGATCTCTTCAGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006362.3-677s1c1
Sequence:CCGGCCGAAGGATATCTATCATCATCTCGAGATGATGATAGATATCCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006362.3-2013s1c1
Sequence:CCGGCCCTGTAAATAGTCCTTGGATCTCGAGATCCAAGGACTATTTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006362.3-1043s1c1
Sequence:CCGGGCGGGAATTGGACAAGATAAACTCGAGTTTATCTTGTCCAATTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006362.3-1149s1c1
Sequence:CCGGCGCGAACGATTTCCCAAGTTACTCGAGTAACTTGGGAAATCGTTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006362
VALIDATED
NXF1 MISSION shRNA shRNA Plasmid DNA
nuclear RNA export factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-1310s21c1
Sequence:CCGGCAACAGTACTATGCAATTTACCTCGAGGTAAATTGCATAGTACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-168s21c1
Sequence:CCGGACGATGATGAACGCGTTAATTCTCGAGAATTAACGCGTTCATCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006362.4-2162s21c1
Sequence:CCGGTCAGAAGATTGAGCCTCACTGCTCGAGCAGTGAGGCTCAATCTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-1422s21c1
Sequence:CCGGGAAGCAGCTTAGCCGAGTATTCTCGAGAATACTCGGCTAAGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-648s21c1
Sequence:CCGGCATTGAAGGCTGTCAACTATACTCGAGTATAGTTGACAGCCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006362.3-1741s1c1
Sequence:CCGGCCAGTTCTGAAGAGATCCAAACTCGAGTTTGGATCTCTTCAGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006362.3-677s1c1
Sequence:CCGGCCGAAGGATATCTATCATCATCTCGAGATGATGATAGATATCCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006362.3-2013s1c1
Sequence:CCGGCCCTGTAAATAGTCCTTGGATCTCGAGATCCAAGGACTATTTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006362.3-1043s1c1
Sequence:CCGGGCGGGAATTGGACAAGATAAACTCGAGTTTATCTTGTCCAATTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006362.3-1149s1c1
Sequence:CCGGCGCGAACGATTTCCCAAGTTACTCGAGTAACTTGGGAAATCGTTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006362
VALIDATED
NXF1 MISSION shRNA Lentiviral Transduction Particles
nuclear RNA export factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-1310s21c1
Sequence:CCGGCAACAGTACTATGCAATTTACCTCGAGGTAAATTGCATAGTACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-168s21c1
Sequence:CCGGACGATGATGAACGCGTTAATTCTCGAGAATTAACGCGTTCATCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006362.4-2162s21c1
Sequence:CCGGTCAGAAGATTGAGCCTCACTGCTCGAGCAGTGAGGCTCAATCTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-1422s21c1
Sequence:CCGGGAAGCAGCTTAGCCGAGTATTCTCGAGAATACTCGGCTAAGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006362.4-648s21c1
Sequence:CCGGCATTGAAGGCTGTCAACTATACTCGAGTATAGTTGACAGCCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006362.3-1741s1c1
Sequence:CCGGCCAGTTCTGAAGAGATCCAAACTCGAGTTTGGATCTCTTCAGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006362.3-677s1c1
Sequence:CCGGCCGAAGGATATCTATCATCATCTCGAGATGATGATAGATATCCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006362.3-2013s1c1
Sequence:CCGGCCCTGTAAATAGTCCTTGGATCTCGAGATCCAAGGACTATTTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006362.3-1043s1c1
Sequence:CCGGGCGGGAATTGGACAAGATAAACTCGAGTTTATCTTGTCCAATTCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006362.3-1149s1c1
Sequence:CCGGCGCGAACGATTTCCCAAGTTACTCGAGTAACTTGGGAAATCGTTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016813
VALIDATED
NXF1 MISSION shRNA Bacterial Glycerol Stock
nuclear RNA export factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016813.2-1959s21c1
Sequence:CCGGGATTCCAGAAGTAGCGTTTATCTCGAGATAAACGCTACTTCTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-572s21c1
Sequence:CCGGCCATCGAGTTTCACTATGAAACTCGAGTTTCATAGTGAAACTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-1151s21c1
Sequence:CCGGGCGAACGATTTCCCAAGTTATCTCGAGATAACTTGGGAAATCGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-1044s21c1
Sequence:CCGGGCGGGAATTAGACAAGATAAACTCGAGTTTATCTTGTCTAATTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-2024s21c1
Sequence:CCGGATATTGTCTGGCTGTCATCTGCTCGAGCAGATGACAGCCAGACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-2119s1c1
Sequence:CCGGCCTTCTGGAAGACTTAGAGAACTCGAGTTCTCTAAGTCTTCCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-331s1c1
Sequence:CCGGCGAGTAAGATACAATCCCTATCTCGAGATAGGGATTGTATCTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-1151s1c1
Sequence:CCGGGCGAACGATTTCCCAAGTTATCTCGAGATAACTTGGGAAATCGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-572s1c1
Sequence:CCGGCCATCGAGTTTCACTATGAAACTCGAGTTTCATAGTGAAACTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-1044s1c1
Sequence:CCGGGCGGGAATTAGACAAGATAAACTCGAGTTTATCTTGTCTAATTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016813
VALIDATED
NXF1 MISSION shRNA shRNA Plasmid DNA
nuclear RNA export factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016813.2-1959s21c1
Sequence:CCGGGATTCCAGAAGTAGCGTTTATCTCGAGATAAACGCTACTTCTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-572s21c1
Sequence:CCGGCCATCGAGTTTCACTATGAAACTCGAGTTTCATAGTGAAACTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-1151s21c1
Sequence:CCGGGCGAACGATTTCCCAAGTTATCTCGAGATAACTTGGGAAATCGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-1044s21c1
Sequence:CCGGGCGGGAATTAGACAAGATAAACTCGAGTTTATCTTGTCTAATTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-2024s21c1
Sequence:CCGGATATTGTCTGGCTGTCATCTGCTCGAGCAGATGACAGCCAGACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-2119s1c1
Sequence:CCGGCCTTCTGGAAGACTTAGAGAACTCGAGTTCTCTAAGTCTTCCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-331s1c1
Sequence:CCGGCGAGTAAGATACAATCCCTATCTCGAGATAGGGATTGTATCTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-1151s1c1
Sequence:CCGGGCGAACGATTTCCCAAGTTATCTCGAGATAACTTGGGAAATCGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-572s1c1
Sequence:CCGGCCATCGAGTTTCACTATGAAACTCGAGTTTCATAGTGAAACTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-1044s1c1
Sequence:CCGGGCGGGAATTAGACAAGATAAACTCGAGTTTATCTTGTCTAATTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016813
VALIDATED
NXF1 MISSION shRNA Lentiviral Transduction Particles
nuclear RNA export factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016813.2-1959s21c1
Sequence:CCGGGATTCCAGAAGTAGCGTTTATCTCGAGATAAACGCTACTTCTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-572s21c1
Sequence:CCGGCCATCGAGTTTCACTATGAAACTCGAGTTTCATAGTGAAACTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-1151s21c1
Sequence:CCGGGCGAACGATTTCCCAAGTTATCTCGAGATAACTTGGGAAATCGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-1044s21c1
Sequence:CCGGGCGGGAATTAGACAAGATAAACTCGAGTTTATCTTGTCTAATTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016813.2-2024s21c1
Sequence:CCGGATATTGTCTGGCTGTCATCTGCTCGAGCAGATGACAGCCAGACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-2119s1c1
Sequence:CCGGCCTTCTGGAAGACTTAGAGAACTCGAGTTCTCTAAGTCTTCCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-331s1c1
Sequence:CCGGCGAGTAAGATACAATCCCTATCTCGAGATAGGGATTGTATCTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-1151s1c1
Sequence:CCGGGCGAACGATTTCCCAAGTTATCTCGAGATAACTTGGGAAATCGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-572s1c1
Sequence:CCGGCCATCGAGTTTCACTATGAAACTCGAGTTTCATAGTGAAACTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016813.2-1044s1c1
Sequence:CCGGGCGGGAATTAGACAAGATAAACTCGAGTTTATCTTGTCTAATTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks