EMAIL THIS PAGE TO A FRIEND

NXPE2

neurexophilin and PC-esterase domain family, member 2

Synonyms: FAM55B
UniProtKB ID: Q96DL1, Q2NKI8
Gene ID:
Mouse(78252) neurexophilin and PC-esterase domain family, member 2
Rat(100363350) neurexophilin and PC-esterase domain family, member 2
sheep(101115226) neurexophilin and PC-esterase domain family, member 2
domestic guinea pig(100733520) neurexophilin and PC-esterase domain family, member 2
naked mole-rat(101719875) neurexophilin and PC-esterase domain family, member 2
domestic cat(101101501) neurexophilin and PC-esterase domain family, member 2
cow(782358) neurexophilin and PC-esterase domain family, member 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182495 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118311 MISSION® esiRNA esiRNA human FAM55B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182495 Rosetta Predictions human pricing
XM_001725616 Rosetta Predictions human pricing
XM_001725952 Rosetta Predictions human pricing
XM_001725989 Rosetta Predictions human pricing
NM_030069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074733 predicted 291
2 SASI_Hs01_00074734 predicted 508
3 SASI_Hs01_00074735 predicted 668
4 SASI_Hs01_00074736 predicted 287
5 SASI_Hs01_00074737 predicted 242
6 SASI_Hs01_00074738 predicted 764
7 SASI_Hs01_00074739 predicted 118
8 SASI_Hs01_00074740 predicted 165
9 SASI_Hs01_00074741 predicted 798
10 SASI_Hs01_00074742 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00468863 predicted 333
2 SASI_Hs02_00468864 predicted 551
3 SASI_Hs02_00468865 predicted 723
4 SASI_Hs02_00468866 predicted 1018
5 SASI_Hs02_00468867 predicted 335
6 SASI_Hs02_00468868 predicted 1275
7 SASI_Hs02_00468869 predicted 892
8 SASI_Hs02_00468870 predicted 1284
9 SASI_Hs02_00468871 predicted 389
10 SASI_Hs02_00468872 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00471025 predicted 341
2 SASI_Hs02_00471026 predicted 552
3 SASI_Hs02_00471027 predicted 724
4 SASI_Hs02_00471028 predicted 1019
5 SASI_Hs02_00471029 predicted 331
6 SASI_Hs02_00471030 predicted 1282
7 SASI_Hs02_00471031 predicted 895
8 SASI_Hs02_00471032 predicted 1288
9 SASI_Hs02_00471033 predicted 384
10 SASI_Hs02_00471034 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00471275 predicted 337
2 SASI_Hs02_00471276 predicted 555
3 SASI_Hs02_00471277 predicted 721
4 SASI_Hs02_00471278 predicted 333
5 SASI_Hs02_00471279 predicted 821
6 SASI_Hs02_00471280 predicted 891
7 SASI_Hs02_00471281 predicted 956
8 SASI_Hs02_00471282 predicted 890
9 SASI_Hs02_00471283 predicted 901
10 SASI_Hs02_00471284 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336455 predicted 940
2 SASI_Mm01_00055383 predicted 1712
3 SASI_Mm01_00055384 predicted 1565
4 SASI_Mm01_00055385 predicted 1498
5 SASI_Mm01_00055386 predicted 1554
6 SASI_Mm01_00055388 predicted 326
7 SASI_Mm01_00055389 predicted 1410
8 SASI_Mm01_00055390 predicted 1304
9 SASI_Mm01_00055391 predicted 1815
10 SASI_Mm01_00055392 predicted 441
11 SASI_Mm01_00055387 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030069
NXPE2 MISSION shRNA Bacterial Glycerol Stock
neurexophilin and PC-esterase domain family, member 2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030069.1-2773s1c1
Sequence:CCGGCCAGAGACACATAGCTTTAATCTCGAGATTAAAGCTATGTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030069.1-346s1c1
Sequence:CCGGCACTTAAACAACCGCATCATTCTCGAGAATGATGCGGTTGTTTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.1-1826s1c1
Sequence:CCGGCGCCTGAAAGCGTGATTGAAACTCGAGTTTCAATCACGCTTTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030069.1-1308s1c1
Sequence:CCGGGCGCCAGTGGATTTACTACTTCTCGAGAAGTAGTAAATCCACTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030069.1-1116s1c1
Sequence:CCGGGCCGTGTAACAACAAGACCAACTCGAGTTGGTCTTGTTGTTACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1013s21c1
Sequence:CCGGAGTGCGGAGCTGTGTCAATATCTCGAGATATTGACACAGCTCCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1971s21c1
Sequence:CCGGACATTTGCTAGAGGGTCTTAACTCGAGTTAAGACCCTCTAGCAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.3-1972s1c1
Sequence:CCGGCATTTGCTAGAGGGTCTTAAGCTCGAGCTTAAGACCCTCTAGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216087    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030069.3-2384s1c1
Sequence:CCGGCACTTAGCACAATGCCTTTAACTCGAGTTAAAGGCATTGTGCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215428    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030069.3-2179s1c1
Sequence:CCGGGTCACACCACCATCATTATAACTCGAGTTATAATGATGGTGGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.3-1330s1c1
Sequence:CCGGGAATGAGTTCAGGGCAATAAACTCGAGTTTATTGCCCTGAACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.3-1499s1c1
Sequence:CCGGCTGGATACTGAACGACATATTCTCGAGAATATGTCGTTCAGTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1923s21c1
Sequence:CCGGATCCGCCTGAAAGCGTGATTGCTCGAGCAATCACGCTTTCAGGCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1821s21c1
Sequence:CCGGGAAGCATTCAGAACCTTATTACTCGAGTAATAAGGTTCTGAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-988s21c1
Sequence:CCGGTGAATGCGGCCTCACCTTAAACTCGAGTTTAAGGTGAGGCCGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030069
NXPE2 MISSION shRNA shRNA Plasmid DNA
neurexophilin and PC-esterase domain family, member 2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030069.1-2773s1c1
Sequence:CCGGCCAGAGACACATAGCTTTAATCTCGAGATTAAAGCTATGTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030069.1-346s1c1
Sequence:CCGGCACTTAAACAACCGCATCATTCTCGAGAATGATGCGGTTGTTTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.1-1826s1c1
Sequence:CCGGCGCCTGAAAGCGTGATTGAAACTCGAGTTTCAATCACGCTTTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030069.1-1308s1c1
Sequence:CCGGGCGCCAGTGGATTTACTACTTCTCGAGAAGTAGTAAATCCACTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030069.1-1116s1c1
Sequence:CCGGGCCGTGTAACAACAAGACCAACTCGAGTTGGTCTTGTTGTTACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1013s21c1
Sequence:CCGGAGTGCGGAGCTGTGTCAATATCTCGAGATATTGACACAGCTCCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1971s21c1
Sequence:CCGGACATTTGCTAGAGGGTCTTAACTCGAGTTAAGACCCTCTAGCAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.3-1972s1c1
Sequence:CCGGCATTTGCTAGAGGGTCTTAAGCTCGAGCTTAAGACCCTCTAGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216087    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030069.3-2384s1c1
Sequence:CCGGCACTTAGCACAATGCCTTTAACTCGAGTTAAAGGCATTGTGCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215428    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030069.3-2179s1c1
Sequence:CCGGGTCACACCACCATCATTATAACTCGAGTTATAATGATGGTGGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.3-1330s1c1
Sequence:CCGGGAATGAGTTCAGGGCAATAAACTCGAGTTTATTGCCCTGAACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.3-1499s1c1
Sequence:CCGGCTGGATACTGAACGACATATTCTCGAGAATATGTCGTTCAGTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1923s21c1
Sequence:CCGGATCCGCCTGAAAGCGTGATTGCTCGAGCAATCACGCTTTCAGGCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1821s21c1
Sequence:CCGGGAAGCATTCAGAACCTTATTACTCGAGTAATAAGGTTCTGAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-988s21c1
Sequence:CCGGTGAATGCGGCCTCACCTTAAACTCGAGTTTAAGGTGAGGCCGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030069
NXPE2 MISSION shRNA Lentiviral Transduction Particles
neurexophilin and PC-esterase domain family, member 2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030069.1-2773s1c1
Sequence:CCGGCCAGAGACACATAGCTTTAATCTCGAGATTAAAGCTATGTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030069.1-346s1c1
Sequence:CCGGCACTTAAACAACCGCATCATTCTCGAGAATGATGCGGTTGTTTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.1-1826s1c1
Sequence:CCGGCGCCTGAAAGCGTGATTGAAACTCGAGTTTCAATCACGCTTTCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030069.1-1308s1c1
Sequence:CCGGGCGCCAGTGGATTTACTACTTCTCGAGAAGTAGTAAATCCACTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030069.1-1116s1c1
Sequence:CCGGGCCGTGTAACAACAAGACCAACTCGAGTTGGTCTTGTTGTTACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1013s21c1
Sequence:CCGGAGTGCGGAGCTGTGTCAATATCTCGAGATATTGACACAGCTCCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1971s21c1
Sequence:CCGGACATTTGCTAGAGGGTCTTAACTCGAGTTAAGACCCTCTAGCAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.3-1972s1c1
Sequence:CCGGCATTTGCTAGAGGGTCTTAAGCTCGAGCTTAAGACCCTCTAGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216087    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030069.3-2384s1c1
Sequence:CCGGCACTTAGCACAATGCCTTTAACTCGAGTTAAAGGCATTGTGCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215428    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030069.3-2179s1c1
Sequence:CCGGGTCACACCACCATCATTATAACTCGAGTTATAATGATGGTGGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.3-1330s1c1
Sequence:CCGGGAATGAGTTCAGGGCAATAAACTCGAGTTTATTGCCCTGAACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030069.3-1499s1c1
Sequence:CCGGCTGGATACTGAACGACATATTCTCGAGAATATGTCGTTCAGTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1923s21c1
Sequence:CCGGATCCGCCTGAAAGCGTGATTGCTCGAGCAATCACGCTTTCAGGCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-1821s21c1
Sequence:CCGGGAAGCATTCAGAACCTTATTACTCGAGTAATAAGGTTCTGAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030069.3-988s21c1
Sequence:CCGGTGAATGCGGCCTCACCTTAAACTCGAGTTTAAGGTGAGGCCGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182495
NXPE2 MISSION shRNA Bacterial Glycerol Stock
neurexophilin and PC-esterase domain family, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182495.3-665s1c1
Sequence:CCGGGAACCAAGGATGTGATAGGATCTCGAGATCCTATCACATCCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-701s1c1
Sequence:CCGGGTTTGCCAACAGAAGCTCCAACTCGAGTTGGAGCTTCTGTTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182495.3-1666s1c1
Sequence:CCGGGCAGCCCAGAAATGCATAGATCTCGAGATCTATGCATTTCTGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-206s1c1
Sequence:CCGGCCTGAACCAAGGGAACATCTTCTCGAGAAGATGTTCCCTTGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-660s1c1
Sequence:CCGGGCAAGGAACCAAGGATGTGATCTCGAGATCACATCCTTGGTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182495.3-848s1c1
Sequence:CCGGCATGACCACTAGGACAAGAAACTCGAGTTTCTTGTCCTAGTGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-503s1c1
Sequence:CCGGGATGTACTCCACAGCACTAATCTCGAGATTAGTGCTGTGGAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182495.3-883s1c1
Sequence:CCGGGCAAGGAAGAATGGAGGCTTTCTCGAGAAAGCCTCCATTCTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182495.3-1837s1c1
Sequence:CCGGCCACAGGCTCATTGAGAGAAACTCGAGTTTCTCTCAATGAGCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182495.3-1669s1c1
Sequence:CCGGGCCCAGAAATGCATAGATTAACTCGAGTTAATCTATGCATTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182495
NXPE2 MISSION shRNA shRNA Plasmid DNA
neurexophilin and PC-esterase domain family, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182495.3-665s1c1
Sequence:CCGGGAACCAAGGATGTGATAGGATCTCGAGATCCTATCACATCCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-701s1c1
Sequence:CCGGGTTTGCCAACAGAAGCTCCAACTCGAGTTGGAGCTTCTGTTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182495.3-1666s1c1
Sequence:CCGGGCAGCCCAGAAATGCATAGATCTCGAGATCTATGCATTTCTGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-206s1c1
Sequence:CCGGCCTGAACCAAGGGAACATCTTCTCGAGAAGATGTTCCCTTGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-660s1c1
Sequence:CCGGGCAAGGAACCAAGGATGTGATCTCGAGATCACATCCTTGGTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182495.3-848s1c1
Sequence:CCGGCATGACCACTAGGACAAGAAACTCGAGTTTCTTGTCCTAGTGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-503s1c1
Sequence:CCGGGATGTACTCCACAGCACTAATCTCGAGATTAGTGCTGTGGAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182495.3-883s1c1
Sequence:CCGGGCAAGGAAGAATGGAGGCTTTCTCGAGAAAGCCTCCATTCTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182495.3-1837s1c1
Sequence:CCGGCCACAGGCTCATTGAGAGAAACTCGAGTTTCTCTCAATGAGCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182495.3-1669s1c1
Sequence:CCGGGCCCAGAAATGCATAGATTAACTCGAGTTAATCTATGCATTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182495
NXPE2 MISSION shRNA Lentiviral Transduction Particles
neurexophilin and PC-esterase domain family, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182495.3-665s1c1
Sequence:CCGGGAACCAAGGATGTGATAGGATCTCGAGATCCTATCACATCCTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-701s1c1
Sequence:CCGGGTTTGCCAACAGAAGCTCCAACTCGAGTTGGAGCTTCTGTTGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182495.3-1666s1c1
Sequence:CCGGGCAGCCCAGAAATGCATAGATCTCGAGATCTATGCATTTCTGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-206s1c1
Sequence:CCGGCCTGAACCAAGGGAACATCTTCTCGAGAAGATGTTCCCTTGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-660s1c1
Sequence:CCGGGCAAGGAACCAAGGATGTGATCTCGAGATCACATCCTTGGTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182495.3-848s1c1
Sequence:CCGGCATGACCACTAGGACAAGAAACTCGAGTTTCTTGTCCTAGTGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182495.3-503s1c1
Sequence:CCGGGATGTACTCCACAGCACTAATCTCGAGATTAGTGCTGTGGAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182495.3-883s1c1
Sequence:CCGGGCAAGGAAGAATGGAGGCTTTCTCGAGAAAGCCTCCATTCTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182495.3-1837s1c1
Sequence:CCGGCCACAGGCTCATTGAGAGAAACTCGAGTTTCTCTCAATGAGCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144968    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182495.3-1669s1c1
Sequence:CCGGGCCCAGAAATGCATAGATTAACTCGAGTTAATCTATGCATTTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks