EMAIL THIS PAGE TO A FRIEND

NXPH3

neurexophilin 3

Synonyms: NPH3
UniProtKB ID: O95157, Q8NDC3, Q8TBF6, Q9ULR1
Gene ID:
Mouse(104079) neurexophilin 3
Rat(59315) neurexophilin 3
chicken(429523) neurexophilin 3
cow(541093) neurexophilin 3
domestic cat(101101014) neurexophilin 3
dog(612866) neurexophilin 3
sheep(101111562) neurexophilin 3
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007225 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU088351 MISSION® esiRNA esiRNA targeting mouse Nxph3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007225 Rosetta Predictions human pricing
NM_021679 Rosetta Predictions rat pricing
NM_130858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020961 predicted 752
2 SASI_Hs01_00020962 predicted 1055
3 SASI_Hs01_00020963 predicted 809
4 SASI_Hs01_00020964 predicted 782
5 SASI_Hs01_00020965 predicted 406
6 SASI_Hs01_00020966 predicted 1215
7 SASI_Hs01_00020967 predicted 252
8 SASI_Hs01_00020968 predicted 1113
9 SASI_Hs02_00343226 predicted 454
10 SASI_Hs02_00343227 predicted 1277
11 SASI_Hs01_00020960 predicted 1006
12 SASI_Hs01_00020969 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041730 predicted 857
2 SASI_Rn01_00041732 predicted 647
3 SASI_Rn01_00041733 predicted 463
4 SASI_Rn01_00041734 predicted 854
5 SASI_Rn02_00262700 predicted 504
6 SASI_Rn02_00262701 predicted 289
7 SASI_Rn02_00262702 predicted 856
8 SASI_Rn01_00041736 predicted 615
9 SASI_Rn01_00041737 predicted 567
10 SASI_Rn01_00041738 predicted 600
11 SASI_Rn01_00041731 predicted 656
12 SASI_Rn01_00041735 predicted 339
13 SASI_Rn01_00041739 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338274 predicted 795
2 SASI_Mm01_00140219 predicted 1008
3 SASI_Mm01_00140220 predicted 488
4 SASI_Mm01_00140221 predicted 1277
5 SASI_Mm01_00140222 predicted 753
6 SASI_Mm01_00140223 predicted 1095
7 SASI_Mm01_00140224 predicted 493
8 SASI_Mm01_00140225 predicted 1020
9 SASI_Mm01_00140226 predicted 1058
10 SASI_Mm01_00140227 predicted 710
11 SASI_Mm01_00140228 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130858
NXPH3 MISSION shRNA Bacterial Glycerol Stock
neurexophilin 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130858.3-1054s21c1
Sequence:CCGGGAAGGTGTGCCCAGATTACAACTCGAGTTGTAATCTGGGCACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130858.3-714s21c1
Sequence:CCGGAGATTGTGGACCACGGAAACGCTCGAGCGTTTCCGTGGTCCACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-717s1c1
Sequence:CCGGGCGTCTATATTGCCTTCTATACTCGAGTATAGAAGGCAATATAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-715s1c1
Sequence:CCGGCTGCGTCTATATTGCCTTCTACTCGAGTAGAAGGCAATATAGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-728s1c1
Sequence:CCGGGCCTTCTATAGCACGGACTATCTCGAGATAGTCCGTGCTATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-205s1c1
Sequence:CCGGGCGAGGTCATATCTCACCTAACTCGAGTTAGGTGAGATATGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130858
NXPH3 MISSION shRNA shRNA Plasmid DNA
neurexophilin 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130858.3-1054s21c1
Sequence:CCGGGAAGGTGTGCCCAGATTACAACTCGAGTTGTAATCTGGGCACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130858.3-714s21c1
Sequence:CCGGAGATTGTGGACCACGGAAACGCTCGAGCGTTTCCGTGGTCCACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-717s1c1
Sequence:CCGGGCGTCTATATTGCCTTCTATACTCGAGTATAGAAGGCAATATAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-715s1c1
Sequence:CCGGCTGCGTCTATATTGCCTTCTACTCGAGTAGAAGGCAATATAGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-728s1c1
Sequence:CCGGGCCTTCTATAGCACGGACTATCTCGAGATAGTCCGTGCTATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-205s1c1
Sequence:CCGGGCGAGGTCATATCTCACCTAACTCGAGTTAGGTGAGATATGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130858
NXPH3 MISSION shRNA Lentiviral Transduction Particles
neurexophilin 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130858.3-1054s21c1
Sequence:CCGGGAAGGTGTGCCCAGATTACAACTCGAGTTGTAATCTGGGCACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130858.3-714s21c1
Sequence:CCGGAGATTGTGGACCACGGAAACGCTCGAGCGTTTCCGTGGTCCACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-717s1c1
Sequence:CCGGGCGTCTATATTGCCTTCTATACTCGAGTATAGAAGGCAATATAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-715s1c1
Sequence:CCGGCTGCGTCTATATTGCCTTCTACTCGAGTAGAAGGCAATATAGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-728s1c1
Sequence:CCGGGCCTTCTATAGCACGGACTATCTCGAGATAGTCCGTGCTATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130858.1-205s1c1
Sequence:CCGGGCGAGGTCATATCTCACCTAACTCGAGTTAGGTGAGATATGACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007225
NXPH3 MISSION shRNA Bacterial Glycerol Stock
neurexophilin 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-774s1c1
Sequence:CCGGCCTTCTACAGCACGGACTATCCTCGAGGATAGTCCGTGCTGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-495s1c1
Sequence:CCGGGCGTCCACTTCCAACACAATGCTCGAGCATTGTGTTGGAAGTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007225.1-1285s1c1
Sequence:CCGGGCCTGTCAACTTAGGATGGATCTCGAGATCCATCCTAAGTTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-818s1c1
Sequence:CCGGGATTACAACTACCATAGTGATCTCGAGATCACTATGGTAGTTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-751s1c1
Sequence:CCGGCAAAGTCGTCTGTGTCTACATCTCGAGATGTAGACACAGACGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007225.1-1441s1c1
Sequence:CCGGGTCTTTGATGTCTTGACAGATCTCGAGATCTGTCAAGACATCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-463s1c1
Sequence:CCGGGAAGATTGTGGACCATGGCAACTCGAGTTGCCATGGTCCACAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-815s1c1
Sequence:CCGGCCAGATTACAACTACCATAGTCTCGAGACTATGGTAGTTGTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-412s1c1
Sequence:CCGGCGACTTCTACTCCAACATCAACTCGAGTTGATGTTGGAGTAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-586s1c1
Sequence:CCGGGCAGATCTTCATCGAAGCCAACTCGAGTTGGCTTCGATGAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007225
NXPH3 MISSION shRNA shRNA Plasmid DNA
neurexophilin 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-774s1c1
Sequence:CCGGCCTTCTACAGCACGGACTATCCTCGAGGATAGTCCGTGCTGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-495s1c1
Sequence:CCGGGCGTCCACTTCCAACACAATGCTCGAGCATTGTGTTGGAAGTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007225.1-1285s1c1
Sequence:CCGGGCCTGTCAACTTAGGATGGATCTCGAGATCCATCCTAAGTTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-818s1c1
Sequence:CCGGGATTACAACTACCATAGTGATCTCGAGATCACTATGGTAGTTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-751s1c1
Sequence:CCGGCAAAGTCGTCTGTGTCTACATCTCGAGATGTAGACACAGACGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007225.1-1441s1c1
Sequence:CCGGGTCTTTGATGTCTTGACAGATCTCGAGATCTGTCAAGACATCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-463s1c1
Sequence:CCGGGAAGATTGTGGACCATGGCAACTCGAGTTGCCATGGTCCACAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-815s1c1
Sequence:CCGGCCAGATTACAACTACCATAGTCTCGAGACTATGGTAGTTGTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-412s1c1
Sequence:CCGGCGACTTCTACTCCAACATCAACTCGAGTTGATGTTGGAGTAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-586s1c1
Sequence:CCGGGCAGATCTTCATCGAAGCCAACTCGAGTTGGCTTCGATGAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007225
NXPH3 MISSION shRNA Lentiviral Transduction Particles
neurexophilin 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-774s1c1
Sequence:CCGGCCTTCTACAGCACGGACTATCCTCGAGGATAGTCCGTGCTGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-495s1c1
Sequence:CCGGGCGTCCACTTCCAACACAATGCTCGAGCATTGTGTTGGAAGTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007225.1-1285s1c1
Sequence:CCGGGCCTGTCAACTTAGGATGGATCTCGAGATCCATCCTAAGTTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-818s1c1
Sequence:CCGGGATTACAACTACCATAGTGATCTCGAGATCACTATGGTAGTTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-751s1c1
Sequence:CCGGCAAAGTCGTCTGTGTCTACATCTCGAGATGTAGACACAGACGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007225.1-1441s1c1
Sequence:CCGGGTCTTTGATGTCTTGACAGATCTCGAGATCTGTCAAGACATCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-463s1c1
Sequence:CCGGGAAGATTGTGGACCATGGCAACTCGAGTTGCCATGGTCCACAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-815s1c1
Sequence:CCGGCCAGATTACAACTACCATAGTCTCGAGACTATGGTAGTTGTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-412s1c1
Sequence:CCGGCGACTTCTACTCCAACATCAACTCGAGTTGATGTTGGAGTAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007225.1-586s1c1
Sequence:CCGGGCAGATCTTCATCGAAGCCAACTCGAGTTGGCTTCGATGAAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks