EMAIL THIS PAGE TO A FRIEND

OAF

OAF homolog (Drosophila)

Synonyms: NS5ATP13TP2
UniProtKB ID: Q86UD1
Gene ID:
Mouse(102644) OAF homolog (Drosophila)
Rat(315594) OAF homolog (Drosophila)
fruit fly(33435) out at first
cow(514557) OAF homolog (Drosophila)
domestic cat(101085150) OAF homolog (Drosophila)
chicken(395161) OAF homolog (Drosophila)
dog(489361) OAF homolog (Drosophila)
domestic guinea pig(100724212) OAF homolog (Drosophila)
naked mole-rat(101714921) OAF homolog (Drosophila)
sheep(101116676) OAF homolog (Drosophila)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178507 Rosetta Predictions human pricing
NM_001014090 Rosetta Predictions rat pricing
NM_178644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085523 predicted 1397
2 SASI_Hs01_00085524 predicted 1382
3 SASI_Hs01_00085525 predicted 1089
4 SASI_Hs01_00085526 predicted 1401
5 SASI_Hs01_00085527 predicted 640
6 SASI_Hs01_00085529 predicted 1199
7 SASI_Hs01_00085530 predicted 977
8 SASI_Hs02_00369749 predicted 652
9 SASI_Hs01_00085528 predicted 775
10 SASI_Hs01_00085532 predicted 449
11 SASI_Hs01_00085531 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098307 predicted 511
2 SASI_Rn02_00201517 predicted 1299
3 SASI_Rn01_00098308 predicted 1201
4 SASI_Rn01_00098309 predicted 774
5 SASI_Rn01_00098310 predicted 622
6 SASI_Rn01_00098311 predicted 837
7 SASI_Rn02_00201518 predicted 974
8 SASI_Rn01_00098314 predicted 1432
9 SASI_Rn02_00201519 predicted 953
10 SASI_Rn02_00201520 predicted 736
11 SASI_Rn01_00098305 predicted 960
12 SASI_Rn01_00098306 predicted 605
13 SASI_Rn01_00098312 predicted 859
14 SASI_Rn01_00098313 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059325 predicted 1026
2 SASI_Mm01_00059326 predicted 858
3 SASI_Mm01_00059327 predicted 563
4 SASI_Mm01_00059328 predicted 751
5 SASI_Mm01_00059329 predicted 1579
6 SASI_Mm01_00059330 predicted 874
7 SASI_Mm01_00059331 predicted 680
8 SASI_Mm01_00059332 predicted 817
9 SASI_Mm01_00059333 predicted 931
10 SASI_Mm01_00059334 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178507
VALIDATED
OAF MISSION shRNA Bacterial Glycerol Stock
OAF homolog (Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-551s21c1
Sequence:CCGGACCCAGCTGCAGCACAATGAGCTCGAGCTCATTGTGCTGCAGCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178507.2-1373s21c1
Sequence:CCGGATGATGGCCTCTGGTTGTTCTCTCGAGAGAACAACCAGAGGCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-669s21c1
Sequence:CCGGATGTCGCTGTCAACTTCAGCCCTCGAGGGCTGAAGTTGACAGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178507.2-1394s21c1
Sequence:CCGGGTTGAACTCCTTGAACGTTTACTCGAGTAAACGTTCAAGGAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-920s21c1
Sequence:CCGGTGCATGCTCAAGTACTGCCACCTCGAGGTGGCAGTACTTGAGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-708s21c1
Sequence:CCGGCCCATCTCCACAACGTGTGTGCTCGAGCACACACGTTGTGGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-993s21c1
Sequence:CCGGGCTACAGCTTCGACTTCTACGCTCGAGCGTAGAAGTCGAAGCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178507.2-1201s1c1
Sequence:CCGGCCCATCTCACATGACTGTGAACTCGAGTTCACAGTCATGTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_178507.2-661s1c1
Sequence:CCGGGCACATGGATGTCGCTGTCAACTCGAGTTGACAGCGACATCCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178507.2-780s1c1
Sequence:CCGGTGGAGCAAGGTGTGGACAGTTCTCGAGAACTGTCCACACCTTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178507.2-960s1c1
Sequence:CCGGCCTACAAGTGTGGCATCCGCACTCGAGTGCGGATGCCACACTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178507.2-457s1c1
Sequence:CCGGCGCCGACTTCAAGAAGGATGTCTCGAGACATCCTTCTTGAAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178507
VALIDATED
OAF MISSION shRNA shRNA Plasmid DNA
OAF homolog (Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-551s21c1
Sequence:CCGGACCCAGCTGCAGCACAATGAGCTCGAGCTCATTGTGCTGCAGCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178507.2-1373s21c1
Sequence:CCGGATGATGGCCTCTGGTTGTTCTCTCGAGAGAACAACCAGAGGCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-669s21c1
Sequence:CCGGATGTCGCTGTCAACTTCAGCCCTCGAGGGCTGAAGTTGACAGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178507.2-1394s21c1
Sequence:CCGGGTTGAACTCCTTGAACGTTTACTCGAGTAAACGTTCAAGGAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-920s21c1
Sequence:CCGGTGCATGCTCAAGTACTGCCACCTCGAGGTGGCAGTACTTGAGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-708s21c1
Sequence:CCGGCCCATCTCCACAACGTGTGTGCTCGAGCACACACGTTGTGGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-993s21c1
Sequence:CCGGGCTACAGCTTCGACTTCTACGCTCGAGCGTAGAAGTCGAAGCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178507.2-1201s1c1
Sequence:CCGGCCCATCTCACATGACTGTGAACTCGAGTTCACAGTCATGTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_178507.2-661s1c1
Sequence:CCGGGCACATGGATGTCGCTGTCAACTCGAGTTGACAGCGACATCCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178507.2-780s1c1
Sequence:CCGGTGGAGCAAGGTGTGGACAGTTCTCGAGAACTGTCCACACCTTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178507.2-960s1c1
Sequence:CCGGCCTACAAGTGTGGCATCCGCACTCGAGTGCGGATGCCACACTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178507.2-457s1c1
Sequence:CCGGCGCCGACTTCAAGAAGGATGTCTCGAGACATCCTTCTTGAAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178507
VALIDATED
OAF MISSION shRNA Lentiviral Transduction Particles
OAF homolog (Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-551s21c1
Sequence:CCGGACCCAGCTGCAGCACAATGAGCTCGAGCTCATTGTGCTGCAGCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178507.2-1373s21c1
Sequence:CCGGATGATGGCCTCTGGTTGTTCTCTCGAGAGAACAACCAGAGGCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-669s21c1
Sequence:CCGGATGTCGCTGTCAACTTCAGCCCTCGAGGGCTGAAGTTGACAGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178507.2-1394s21c1
Sequence:CCGGGTTGAACTCCTTGAACGTTTACTCGAGTAAACGTTCAAGGAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-920s21c1
Sequence:CCGGTGCATGCTCAAGTACTGCCACCTCGAGGTGGCAGTACTTGAGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-708s21c1
Sequence:CCGGCCCATCTCCACAACGTGTGTGCTCGAGCACACACGTTGTGGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178507.2-993s21c1
Sequence:CCGGGCTACAGCTTCGACTTCTACGCTCGAGCGTAGAAGTCGAAGCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178507.2-1201s1c1
Sequence:CCGGCCCATCTCACATGACTGTGAACTCGAGTTCACAGTCATGTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_178507.2-661s1c1
Sequence:CCGGGCACATGGATGTCGCTGTCAACTCGAGTTGACAGCGACATCCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178507.2-780s1c1
Sequence:CCGGTGGAGCAAGGTGTGGACAGTTCTCGAGAACTGTCCACACCTTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178507.2-960s1c1
Sequence:CCGGCCTACAAGTGTGGCATCCGCACTCGAGTGCGGATGCCACACTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178507.2-457s1c1
Sequence:CCGGCGCCGACTTCAAGAAGGATGTCTCGAGACATCCTTCTTGAAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178644
VALIDATED
OAF MISSION shRNA Bacterial Glycerol Stock
OAF homolog (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178644.3-1031s1c1
Sequence:CCGGGCTACACCTTTGACTTCTATGCTCGAGCATAGAAGTCAAAGGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178644.3-2029s21c1
Sequence:CCGGCACCTGTAACATCAACATAATCTCGAGATTATGTTGATGTTACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178644.3-483s21c1
Sequence:CCGGCATCTCCTTCATCGCGGATTTCTCGAGAAATCCGCGATGAAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178644.3-953s21c1
Sequence:CCGGACCCATGCATGCTCAAGTATTCTCGAGAATACTTGAGCATGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178644.3-587s21c1
Sequence:CCGGTCACAAGGCTGCACCACAATGCTCGAGCATTGTGGTGCAGCCTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178644.3-684s21c1
Sequence:CCGGGGGTCTGGAACAGTTACATATCTCGAGATATGTAACTGTTCCAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178644.2-862s1c1
Sequence:CCGGGCATTAGAACAGGCGGAATTACTCGAGTAATTCCGCCTGTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178644
VALIDATED
OAF MISSION shRNA shRNA Plasmid DNA
OAF homolog (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178644.3-1031s1c1
Sequence:CCGGGCTACACCTTTGACTTCTATGCTCGAGCATAGAAGTCAAAGGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178644.3-2029s21c1
Sequence:CCGGCACCTGTAACATCAACATAATCTCGAGATTATGTTGATGTTACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178644.3-483s21c1
Sequence:CCGGCATCTCCTTCATCGCGGATTTCTCGAGAAATCCGCGATGAAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178644.3-953s21c1
Sequence:CCGGACCCATGCATGCTCAAGTATTCTCGAGAATACTTGAGCATGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178644.3-587s21c1
Sequence:CCGGTCACAAGGCTGCACCACAATGCTCGAGCATTGTGGTGCAGCCTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178644.3-684s21c1
Sequence:CCGGGGGTCTGGAACAGTTACATATCTCGAGATATGTAACTGTTCCAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178644.2-862s1c1
Sequence:CCGGGCATTAGAACAGGCGGAATTACTCGAGTAATTCCGCCTGTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178644
VALIDATED
OAF MISSION shRNA Lentiviral Transduction Particles
OAF homolog (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178644.3-1031s1c1
Sequence:CCGGGCTACACCTTTGACTTCTATGCTCGAGCATAGAAGTCAAAGGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178644.3-2029s21c1
Sequence:CCGGCACCTGTAACATCAACATAATCTCGAGATTATGTTGATGTTACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178644.3-483s21c1
Sequence:CCGGCATCTCCTTCATCGCGGATTTCTCGAGAAATCCGCGATGAAGGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178644.3-953s21c1
Sequence:CCGGACCCATGCATGCTCAAGTATTCTCGAGAATACTTGAGCATGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178644.3-587s21c1
Sequence:CCGGTCACAAGGCTGCACCACAATGCTCGAGCATTGTGGTGCAGCCTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178644.3-684s21c1
Sequence:CCGGGGGTCTGGAACAGTTACATATCTCGAGATATGTAACTGTTCCAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178644.2-862s1c1
Sequence:CCGGGCATTAGAACAGGCGGAATTACTCGAGTAATTCCGCCTGTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks