EMAIL THIS PAGE TO A FRIEND

OCIAD2

OCIA domain containing 2

UniProtKB ID: Q56VL3, B4DPE7, Q8N544
Gene ID:
Mouse(433904) OCIA domain containing 2
Rat(100361733) OCIA domain containing 2
Zebrafish(558261) OCIA domain containing 2
dog(100688134) OCIA domain containing 2
domestic cat(101094175) OCIA domain containing 2
cow(505877) OCIA domain containing 2
naked mole-rat(101708082) OCIA domain containing 2
domestic guinea pig(100722267) OCIA domain containing 2
sheep(101103814) OCIA domain containing 2
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152398 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014446 Rosetta Predictions human pricing
NM_152398 Rosetta Predictions human pricing
NM_026950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161225 predicted 485
2 SASI_Hs01_00161227 predicted 401
3 SASI_Hs01_00161228 predicted 408
4 SASI_Hs02_00306552 predicted 464
5 SASI_Hs02_00306553 predicted 305
6 SASI_Hs01_00161230 predicted 255
7 SASI_Hs01_00161231 predicted 403
8 SASI_Hs01_00161233 predicted 229
9 SASI_Hs01_00161234 predicted 511
10 SASI_Hs02_00306554 predicted 394
11 SASI_Hs01_00161226 predicted 417
12 SASI_Hs01_00161229 predicted 319
13 SASI_Hs01_00161232 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140278 predicted 399
2 SASI_Hs01_00140279 predicted 415
3 SASI_Hs02_00366078 predicted 303
4 SASI_Hs01_00140281 predicted 253
5 SASI_Hs01_00140282 predicted 396
6 SASI_Hs01_00140284 predicted 229
7 SASI_Hs01_00140285 predicted 395
8 SASI_Hs01_00140286 predicted 341
9 SASI_Hs02_00366079 predicted 256
10 SASI_Hs02_00366080 predicted 312
11 SASI_Hs01_00140277 predicted 418
12 SASI_Hs01_00140280 predicted 320
13 SASI_Hs01_00140283 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331264 predicted 1110
2 SASI_Mm02_00331265 predicted 842
3 SASI_Mm01_00140599 predicted 550
4 SASI_Mm02_00331266 predicted 1101
5 SASI_Mm02_00331267 predicted 611
6 SASI_Mm02_00331268 predicted 1038
7 SASI_Mm01_00140601 predicted 288
8 SASI_Mm01_00140602 predicted 374
9 SASI_Mm02_00331269 predicted 760
10 SASI_Mm01_00140604 predicted 482
11 SASI_Mm01_00140597 predicted 558
12 SASI_Mm01_00140598 predicted 580
13 SASI_Mm01_00140600 predicted 372
14 SASI_Mm01_00140603 predicted 294
15 SASI_Mm01_00140605 predicted 590
16 SASI_Mm01_00140606 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152398
VALIDATED
OCIAD2 MISSION shRNA Bacterial Glycerol Stock
OCIA domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-315s21c1
Sequence:CCGGGAGATCTCAAAGATTATGCGACTCGAGTCGCATAATCTTTGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-345s21c1
Sequence:CCGGGAAGAAAGTTTCTGGAAGAGACTCGAGTCTCTTCCAGAAACTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-505s21c1
Sequence:CCGGGCATGGATTAAGTGAGAAGGGCTCGAGCCCTTCTCACTTAATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-334s21c1
Sequence:CCGGGAGAATGTCAGGAAGAAAGTTCTCGAGAACTTTCTTCCTGACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152398.2-505s1c1
Sequence:CCGGGCATGGATTAAGTGAGAAGGGCTCGAGCCCTTCTCACTTAATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152398.2-315s1c1
Sequence:CCGGGAGATCTCAAAGATTATGCGACTCGAGTCGCATAATCTTTGAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152398.2-345s1c1
Sequence:CCGGGAAGAAAGTTTCTGGAAGAGACTCGAGTCTCTTCCAGAAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152398.2-310s1c1
Sequence:CCGGGAGCAGAGATCTCAAAGATTACTCGAGTAATCTTTGAGATCTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152398.2-334s1c1
Sequence:CCGGGAGAATGTCAGGAAGAAAGTTCTCGAGAACTTTCTTCCTGACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152398
VALIDATED
OCIAD2 MISSION shRNA shRNA Plasmid DNA
OCIA domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-315s21c1
Sequence:CCGGGAGATCTCAAAGATTATGCGACTCGAGTCGCATAATCTTTGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-345s21c1
Sequence:CCGGGAAGAAAGTTTCTGGAAGAGACTCGAGTCTCTTCCAGAAACTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-505s21c1
Sequence:CCGGGCATGGATTAAGTGAGAAGGGCTCGAGCCCTTCTCACTTAATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-334s21c1
Sequence:CCGGGAGAATGTCAGGAAGAAAGTTCTCGAGAACTTTCTTCCTGACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152398.2-505s1c1
Sequence:CCGGGCATGGATTAAGTGAGAAGGGCTCGAGCCCTTCTCACTTAATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152398.2-315s1c1
Sequence:CCGGGAGATCTCAAAGATTATGCGACTCGAGTCGCATAATCTTTGAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152398.2-345s1c1
Sequence:CCGGGAAGAAAGTTTCTGGAAGAGACTCGAGTCTCTTCCAGAAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152398.2-310s1c1
Sequence:CCGGGAGCAGAGATCTCAAAGATTACTCGAGTAATCTTTGAGATCTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152398.2-334s1c1
Sequence:CCGGGAGAATGTCAGGAAGAAAGTTCTCGAGAACTTTCTTCCTGACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152398
VALIDATED
OCIAD2 MISSION shRNA Lentiviral Transduction Particles
OCIA domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-315s21c1
Sequence:CCGGGAGATCTCAAAGATTATGCGACTCGAGTCGCATAATCTTTGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-345s21c1
Sequence:CCGGGAAGAAAGTTTCTGGAAGAGACTCGAGTCTCTTCCAGAAACTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318951    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-505s21c1
Sequence:CCGGGCATGGATTAAGTGAGAAGGGCTCGAGCCCTTCTCACTTAATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_152398.2-334s21c1
Sequence:CCGGGAGAATGTCAGGAAGAAAGTTCTCGAGAACTTTCTTCCTGACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152398.2-505s1c1
Sequence:CCGGGCATGGATTAAGTGAGAAGGGCTCGAGCCCTTCTCACTTAATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152398.2-315s1c1
Sequence:CCGGGAGATCTCAAAGATTATGCGACTCGAGTCGCATAATCTTTGAGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152398.2-345s1c1
Sequence:CCGGGAAGAAAGTTTCTGGAAGAGACTCGAGTCTCTTCCAGAAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152398.2-310s1c1
Sequence:CCGGGAGCAGAGATCTCAAAGATTACTCGAGTAATCTTTGAGATCTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152398.2-334s1c1
Sequence:CCGGGAGAATGTCAGGAAGAAAGTTCTCGAGAACTTTCTTCCTGACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026950
OCIAD2 MISSION shRNA Bacterial Glycerol Stock
OCIA domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-408s21c1
Sequence:CCGGGATTTGGATCATTGCCTAAAGCTCGAGCTTTAGGCAATGATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-373s21c1
Sequence:CCGGACTCGTCCACCAAGGTTATTTCTCGAGAAATAACCTTGGTGGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-457s21c1
Sequence:CCGGCCTTGGGAAGGCTTCCTATATCTCGAGATATAGGAAGCCTTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-563s21c1
Sequence:CCGGCTTACCTGTGAGGACTGTAAACTCGAGTTTACAGTCCTCACAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026950.3-784s21c1
Sequence:CCGGTTGACATGAGCGTGGCATATTCTCGAGAATATGCCACGCTCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026950
OCIAD2 MISSION shRNA shRNA Plasmid DNA
OCIA domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-408s21c1
Sequence:CCGGGATTTGGATCATTGCCTAAAGCTCGAGCTTTAGGCAATGATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-373s21c1
Sequence:CCGGACTCGTCCACCAAGGTTATTTCTCGAGAAATAACCTTGGTGGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-457s21c1
Sequence:CCGGCCTTGGGAAGGCTTCCTATATCTCGAGATATAGGAAGCCTTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-563s21c1
Sequence:CCGGCTTACCTGTGAGGACTGTAAACTCGAGTTTACAGTCCTCACAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026950.3-784s21c1
Sequence:CCGGTTGACATGAGCGTGGCATATTCTCGAGAATATGCCACGCTCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026950
OCIAD2 MISSION shRNA Lentiviral Transduction Particles
OCIA domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-408s21c1
Sequence:CCGGGATTTGGATCATTGCCTAAAGCTCGAGCTTTAGGCAATGATCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-373s21c1
Sequence:CCGGACTCGTCCACCAAGGTTATTTCTCGAGAAATAACCTTGGTGGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-457s21c1
Sequence:CCGGCCTTGGGAAGGCTTCCTATATCTCGAGATATAGGAAGCCTTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026950.3-563s21c1
Sequence:CCGGCTTACCTGTGAGGACTGTAAACTCGAGTTTACAGTCCTCACAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026950.3-784s21c1
Sequence:CCGGTTGACATGAGCGTGGCATATTCTCGAGAATATGCCACGCTCATGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks