EMAIL THIS PAGE TO A FRIEND

OCLN

occludin

Synonyms: BLCPMG
Gene ID:
Human(100506658) Summary: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
Mouse(18260) occludin
Rat(83497) occludin
chicken(396026) occludin
cow(512405) occludin
Horse(100073306) occludin
dog(403844) occludin
sheep(101118304) occludin
sheep(443201) occludin
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031329 Rosetta Predictions rat pricing
NM_008756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096936 predicted 957
2 SASI_Rn01_00096938 predicted 353
3 SASI_Rn01_00096939 predicted 1597
4 SASI_Rn01_00096940 predicted 661
5 SASI_Rn01_00096941 predicted 944
6 SASI_Rn01_00096942 predicted 680
7 SASI_Rn02_00264549 predicted 985
8 SASI_Rn02_00264550 predicted 1580
9 SASI_Rn01_00096943 predicted 1759
10 SASI_Rn01_00096944 predicted 492
11 SASI_Rn01_00096937 predicted 989
12 SASI_Rn01_00096945 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314635 predicted 1711
2 SASI_Mm02_00314636 predicted 1171
3 SASI_Mm02_00314637 predicted 1661
4 SASI_Mm02_00314638 predicted 983
5 SASI_Mm02_00314639 predicted 689
6 SASI_Mm02_00314640 predicted 1623
7 SASI_Mm02_00314641 predicted 1008
8 SASI_Mm02_00314642 predicted 1431
9 SASI_Mm02_00314643 predicted 704
10 SASI_Mm02_00314644 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008756
OCLN MISSION shRNA Bacterial Glycerol Stock
occludin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-547s1c1
Sequence:CCGGGCTATGGCTATGGCGGATATACTCGAGTATATCCGCCATAGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008756.2-2800s1c1
Sequence:CCGGGCTCATTTGATGTCATTAGTACTCGAGTACTAATGACATCAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-975s1c1
Sequence:CCGGCGAAGAAAGATGGATCGGTATCTCGAGATACCGATCCATCTTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-389s1c1
Sequence:CCGGGCTCATTATTGTGATGTGCATCTCGAGATGCACATCACAATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-1120s1c1
Sequence:CCGGCGGAAAGAGTTGACAGTCCAACTCGAGTTGGACTGTCAACTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008756
OCLN MISSION shRNA shRNA Plasmid DNA
occludin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-547s1c1
Sequence:CCGGGCTATGGCTATGGCGGATATACTCGAGTATATCCGCCATAGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008756.2-2800s1c1
Sequence:CCGGGCTCATTTGATGTCATTAGTACTCGAGTACTAATGACATCAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-975s1c1
Sequence:CCGGCGAAGAAAGATGGATCGGTATCTCGAGATACCGATCCATCTTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-389s1c1
Sequence:CCGGGCTCATTATTGTGATGTGCATCTCGAGATGCACATCACAATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-1120s1c1
Sequence:CCGGCGGAAAGAGTTGACAGTCCAACTCGAGTTGGACTGTCAACTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008756
OCLN MISSION shRNA Lentiviral Transduction Particles
occludin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-547s1c1
Sequence:CCGGGCTATGGCTATGGCGGATATACTCGAGTATATCCGCCATAGCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008756.2-2800s1c1
Sequence:CCGGGCTCATTTGATGTCATTAGTACTCGAGTACTAATGACATCAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-975s1c1
Sequence:CCGGCGAAGAAAGATGGATCGGTATCTCGAGATACCGATCCATCTTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-389s1c1
Sequence:CCGGGCTCATTATTGTGATGTGCATCTCGAGATGCACATCACAATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008756.2-1120s1c1
Sequence:CCGGCGGAAAGAGTTGACAGTCCAACTCGAGTTGGACTGTCAACTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks