EMAIL THIS PAGE TO A FRIEND

OCRL

oculocerebrorenal syndrome of Lowe

Synonyms: INPP5F LOCR NPHL2 OCRL-1 OCRL1
Gene ID:
Human(4952) Summary: This gene encodes a phosphatase enzyme that is involved in actin polymerization and is found in the trans-Golgi network. Mutations in this gene cause oculocerebrorenal syndrome of Lowe and also Dent disease. [provided by RefSeq, Jul 2008]
Mouse(320634) oculocerebrorenal syndrome of Lowe
Rat(317576) oculocerebrorenal syndrome of Lowe
fruit fly(31157) Oculocerebrorenal syndrome of Lowe 1 ortholog
Zebrafish(777716) oculocerebrorenal syndrome of Lowe
chicken(422136) oculocerebrorenal syndrome of Lowe
cow(535844) oculocerebrorenal syndrome of Lowe
Horse(100059144) oculocerebrorenal syndrome of Lowe
domestic cat(101101038) oculocerebrorenal syndrome of Lowe
dog(492123) oculocerebrorenal syndrome of Lowe
domestic guinea pig(100733180) oculocerebrorenal syndrome of Lowe
Domestic Rabbit(100346052) oculocerebrorenal syndrome of Lowe
naked mole-rat(101722262) oculocerebrorenal syndrome of Lowe
sheep(101119794) oculocerebrorenal syndrome of Lowe
271 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
O7640 Anti-OCRL (131-145) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
O7765 Anti-OCRL (506-520) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406199 Anti-OCRL antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA012495 Anti-OCRL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410854 Anti-OCRL antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0004952M2 Monoclonal Anti-OCRL antibody produced in mouse clone 4A6, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB5201491 Monoclonal Anti-Ocrl/Inpp5B - Alkaline Phosphatase antibody produced in mouse clone S166A-26, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201492 Monoclonal Anti-Ocrl/Inpp5B - Apc antibody produced in mouse clone S166A-26, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201483 Monoclonal Anti-Ocrl/Inpp5B - Atto 390 antibody produced in mouse clone S166A-26, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201484 Monoclonal Anti-Ocrl/Inpp5B - Atto 488 antibody produced in mouse clone S166A-26, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201485 Monoclonal Anti-Ocrl/Inpp5B - Atto 565 antibody produced in mouse clone S166A-26, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201486 Monoclonal Anti-Ocrl/Inpp5B - Atto 594 antibody produced in mouse clone S166A-26, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201487 Monoclonal Anti-Ocrl/Inpp5B - Atto 633 antibody produced in mouse clone S166A-26, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201488 Monoclonal Anti-Ocrl/Inpp5B - Atto 655 antibody produced in mouse clone S166A-26, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201489 Monoclonal Anti-Ocrl/Inpp5B - Atto 680 antibody produced in mouse clone S166A-26, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201490 Monoclonal Anti-Ocrl/Inpp5B - Atto 700 antibody produced in mouse clone S166A-26, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201493 Monoclonal Anti-Ocrl/Inpp5B - Biotin antibody produced in mouse clone S166A-26, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201494 Monoclonal Anti-Ocrl/Inpp5B - Fitc antibody produced in mouse clone S166A-26, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201495 Monoclonal Anti-Ocrl/Inpp5B - Hrp antibody produced in mouse clone S166A-26, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201496 Monoclonal Anti-Ocrl/Inpp5B - Pe/Atto 594 antibody produced in mouse clone S166A-26, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201497 Monoclonal Anti-Ocrl/Inpp5B - Percp antibody produced in mouse clone S166A-26, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201498 Monoclonal Anti-Ocrl/Inpp5B - Rpe antibody produced in mouse clone S166A-26, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201499 Monoclonal Anti-Ocrl/Inpp5B - Streptavidin antibody produced in mouse clone S166A-26, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201482 Monoclonal Anti-Ocrl/Inpp5B antibody produced in mouse clone S166A-26, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000276 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061391 MISSION® esiRNA esiRNA human OCRL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000276 siRNAs that have been validated in the lab human pricing
NM_001587 Rosetta Predictions human pricing
NM_001108256 Rosetta Predictions rat pricing
NM_177215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000276 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162131 validated 322
1 SASI_Hs01_00162132 validated 1119
1 SASI_Hs01_00162130 validated 2959
2 SASI_Hs01_00162133 predicted 1591
3 SASI_Hs01_00162134 predicted 1084
4 SASI_Hs01_00162135 predicted 463
5 SASI_Hs01_00162136 predicted 306
6 SASI_Hs01_00162137 predicted 1506
7 SASI_Hs01_00162138 predicted 1236
8 SASI_Hs01_00162139 predicted 2854
9 SASI_Hs02_00302233 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064104 predicted 315
2 SASI_Hs01_00064105 predicted 1120
3 SASI_Hs01_00064106 predicted 1591
4 SASI_Hs01_00064107 predicted 1084
5 SASI_Hs01_00064108 predicted 469
6 SASI_Hs01_00064109 predicted 310
7 SASI_Hs01_00064110 predicted 1499
8 SASI_Hs01_00064111 predicted 1237
9 SASI_Hs01_00064112 predicted 2826
10 SASI_Hs02_00332154 predicted 1391
11 SASI_Hs01_00064103 predicted 2934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236864 predicted 2439
2 SASI_Rn02_00236865 predicted 1123
3 SASI_Rn02_00236866 predicted 1558
4 SASI_Rn02_00236867 predicted 1281
5 SASI_Rn02_00236868 predicted 827
6 SASI_Rn02_00236869 predicted 2727
7 SASI_Rn02_00236870 predicted 2908
8 SASI_Rn02_00236871 predicted 2856
9 SASI_Rn02_00236872 predicted 1361
10 SASI_Rn02_00236873 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347239 predicted 800
2 SASI_Mm01_00135392 predicted 348
3 SASI_Mm01_00135393 predicted 928
4 SASI_Mm01_00135394 predicted 1339
5 SASI_Mm01_00135395 predicted 2995
6 SASI_Mm01_00135396 predicted 987
7 SASI_Mm01_00135397 predicted 742
8 SASI_Mm01_00135398 predicted 1182
9 SASI_Mm01_00135399 predicted 597
10 SASI_Mm01_00135400 predicted 1614
11 SASI_Mm01_00135401 predicted 1405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000276
VALIDATED
OCRL MISSION shRNA Bacterial Glycerol Stock
oculocerebrorenal syndrome of Lowe
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000276.3-1090s1c1
Sequence:CCGGGCCAAGTATAAGAAAGTTCAACTCGAGTTGAACTTTCTTATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000276.3-2674s1c1
Sequence:CCGGCGTTACTTGATGGCATTCCTTCTCGAGAAGGAATGCCATCAAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000276.3-783s1c1
Sequence:CCGGGCGGAAGCTCTTTGTACCAAACTCGAGTTTGGTACAAAGAGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000276.3-2646s1c1
Sequence:CCGGGCTTCCGAGATGCCATAGAAACTCGAGTTTCTATGGCATCTCGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000276.3-1134s1c1
Sequence:CCGGGCTTCTTATATTTGCCAGAAACTCGAGTTTCTGGCAAATATAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000276.3-2907s21c1
Sequence:GTACCGGGATCTCGGGCTCCAAGTATTTCTCGAGAAATACTTGGAGCCCGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-2105s21c1
Sequence:CCGGACTCGGGAGAAGATAAGATTGCTCGAGCAATCTTATCTTCTCCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000276.3-1080s21c1
Sequence:GTACCGGGCATTCCAAAGCCAAGTATAACTCGAGTTATACTTGGCTTTGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-3067s21c1
Sequence:CCGGCAAGCCAAAGTTACCATATTTCTCGAGAAATATGGTAACTTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-1161s21c1
Sequence:CCGGGTGTCGATACATTCGTGATATCTCGAGATATCACGAATGTATCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-2646s21c1
Sequence:CCGGGCTTCCGAGATGCCATAGAAACTCGAGTTTCTATGGCATCTCGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000276.3-272s21c1
Sequence:CCGGACGGGCAATATGAGTTAATAACTCGAGTTATTAACTCATATTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000276
VALIDATED
OCRL MISSION shRNA shRNA Plasmid DNA
oculocerebrorenal syndrome of Lowe
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000276.3-1090s1c1
Sequence:CCGGGCCAAGTATAAGAAAGTTCAACTCGAGTTGAACTTTCTTATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000276.3-2674s1c1
Sequence:CCGGCGTTACTTGATGGCATTCCTTCTCGAGAAGGAATGCCATCAAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000276.3-783s1c1
Sequence:CCGGGCGGAAGCTCTTTGTACCAAACTCGAGTTTGGTACAAAGAGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000276.3-2646s1c1
Sequence:CCGGGCTTCCGAGATGCCATAGAAACTCGAGTTTCTATGGCATCTCGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000276.3-1134s1c1
Sequence:CCGGGCTTCTTATATTTGCCAGAAACTCGAGTTTCTGGCAAATATAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000276.3-2907s21c1
Sequence:GTACCGGGATCTCGGGCTCCAAGTATTTCTCGAGAAATACTTGGAGCCCGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-2105s21c1
Sequence:CCGGACTCGGGAGAAGATAAGATTGCTCGAGCAATCTTATCTTCTCCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000276.3-1080s21c1
Sequence:GTACCGGGCATTCCAAAGCCAAGTATAACTCGAGTTATACTTGGCTTTGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-3067s21c1
Sequence:CCGGCAAGCCAAAGTTACCATATTTCTCGAGAAATATGGTAACTTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-1161s21c1
Sequence:CCGGGTGTCGATACATTCGTGATATCTCGAGATATCACGAATGTATCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-2646s21c1
Sequence:CCGGGCTTCCGAGATGCCATAGAAACTCGAGTTTCTATGGCATCTCGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000276.3-272s21c1
Sequence:CCGGACGGGCAATATGAGTTAATAACTCGAGTTATTAACTCATATTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000276
VALIDATED
OCRL MISSION shRNA Lentiviral Transduction Particles
oculocerebrorenal syndrome of Lowe
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000276.3-1090s1c1
Sequence:CCGGGCCAAGTATAAGAAAGTTCAACTCGAGTTGAACTTTCTTATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000276.3-2674s1c1
Sequence:CCGGCGTTACTTGATGGCATTCCTTCTCGAGAAGGAATGCCATCAAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000276.3-783s1c1
Sequence:CCGGGCGGAAGCTCTTTGTACCAAACTCGAGTTTGGTACAAAGAGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000276.3-2646s1c1
Sequence:CCGGGCTTCCGAGATGCCATAGAAACTCGAGTTTCTATGGCATCTCGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000276.3-1134s1c1
Sequence:CCGGGCTTCTTATATTTGCCAGAAACTCGAGTTTCTGGCAAATATAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000276.3-2907s21c1
Sequence:GTACCGGGATCTCGGGCTCCAAGTATTTCTCGAGAAATACTTGGAGCCCGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-2105s21c1
Sequence:CCGGACTCGGGAGAAGATAAGATTGCTCGAGCAATCTTATCTTCTCCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000276.3-1080s21c1
Sequence:GTACCGGGCATTCCAAAGCCAAGTATAACTCGAGTTATACTTGGCTTTGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-3067s21c1
Sequence:CCGGCAAGCCAAAGTTACCATATTTCTCGAGAAATATGGTAACTTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-1161s21c1
Sequence:CCGGGTGTCGATACATTCGTGATATCTCGAGATATCACGAATGTATCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000276.3-2646s21c1
Sequence:CCGGGCTTCCGAGATGCCATAGAAACTCGAGTTTCTATGGCATCTCGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000276.3-272s21c1
Sequence:CCGGACGGGCAATATGAGTTAATAACTCGAGTTATTAACTCATATTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177215
OCRL MISSION shRNA Bacterial Glycerol Stock
oculocerebrorenal syndrome of Lowe
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177215.3-4422s1c1
Sequence:CCGGGCCCTTAAATAATTGGGAGTTCTCGAGAACTCCCAATTATTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-2523s1c1
Sequence:CCGGCCTGAGACAATTCCTGGCAATCTCGAGATTGCCAGGAATTGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-1844s1c1
Sequence:CCGGCGTCCGCATTATGGACAGAATCTCGAGATTCTGTCCATAATGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-638s1c1
Sequence:CCGGGCTTGGATTTGAGGATAATTTCTCGAGAAATTATCCTCAAATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-2715s1c1
Sequence:CCGGGCATTCCTTCGTGAACTCTTACTCGAGTAAGAGTTCACGAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177215
OCRL MISSION shRNA shRNA Plasmid DNA
oculocerebrorenal syndrome of Lowe
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177215.3-4422s1c1
Sequence:CCGGGCCCTTAAATAATTGGGAGTTCTCGAGAACTCCCAATTATTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-2523s1c1
Sequence:CCGGCCTGAGACAATTCCTGGCAATCTCGAGATTGCCAGGAATTGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-1844s1c1
Sequence:CCGGCGTCCGCATTATGGACAGAATCTCGAGATTCTGTCCATAATGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-638s1c1
Sequence:CCGGGCTTGGATTTGAGGATAATTTCTCGAGAAATTATCCTCAAATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-2715s1c1
Sequence:CCGGGCATTCCTTCGTGAACTCTTACTCGAGTAAGAGTTCACGAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177215
OCRL MISSION shRNA Lentiviral Transduction Particles
oculocerebrorenal syndrome of Lowe
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177215.3-4422s1c1
Sequence:CCGGGCCCTTAAATAATTGGGAGTTCTCGAGAACTCCCAATTATTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-2523s1c1
Sequence:CCGGCCTGAGACAATTCCTGGCAATCTCGAGATTGCCAGGAATTGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-1844s1c1
Sequence:CCGGCGTCCGCATTATGGACAGAATCTCGAGATTCTGTCCATAATGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-638s1c1
Sequence:CCGGGCTTGGATTTGAGGATAATTTCTCGAGAAATTATCCTCAAATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177215.3-2715s1c1
Sequence:CCGGGCATTCCTTCGTGAACTCTTACTCGAGTAAGAGTTCACGAAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks