EMAIL THIS PAGE TO A FRIEND

OLIG3

oligodendrocyte transcription factor 3

Synonyms: Bhlhb7 bHLHe20
UniProtKB ID: Q7RTU3, Q8N8Q0
Gene ID:
Mouse(94222) oligodendrocyte transcription factor 3
Rat(293012) oligodendrocyte transcription factor 3
Zebrafish(566728) oligodendrocyte transcription factor 3
domestic cat(101087066) oligodendrocyte transcription factor 3
cow(532191) oligodendrocyte transcription factor 3
chicken(428612) oligodendrocyte transcription factor 3
dog(484005) oligodendrocyte transcription factor 3
sheep(101122285) oligodendrocyte transcription factor 3
domestic guinea pig(100722252) oligodendrocyte transcription factor 3
naked mole-rat(101708093) oligodendrocyte transcription factor 3
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175747 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175747 Rosetta Predictions human pricing
NM_001106269 Rosetta Predictions rat pricing
NM_053008 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163896 predicted 523
2 SASI_Hs01_00163897 predicted 1326
3 SASI_Hs01_00163898 predicted 589
4 SASI_Hs01_00163899 predicted 1331
5 SASI_Hs02_00369102 predicted 1231
6 SASI_Hs01_00163900 predicted 1229
7 SASI_Hs01_00163901 predicted 521
8 SASI_Hs01_00163902 predicted 1017
9 SASI_Hs01_00163904 predicted 967
10 SASI_Hs01_00163905 predicted 1422
11 SASI_Hs01_00163903 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217308 predicted 848
2 SASI_Rn02_00217309 predicted 1139
3 SASI_Rn02_00217310 predicted 1013
4 SASI_Rn02_00217311 predicted 530
5 SASI_Rn02_00217312 predicted 446
6 SASI_Rn02_00217313 predicted 1010
7 SASI_Rn02_00217314 predicted 371
8 SASI_Rn02_00217315 predicted 842
9 SASI_Rn02_00217316 predicted 459
10 SASI_Rn02_00217317 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044743 predicted 869
2 SASI_Mm01_00044744 predicted 1042
3 SASI_Mm02_00337512 predicted 1116
4 SASI_Mm01_00044745 predicted 1181
5 SASI_Mm01_00044746 predicted 547
6 SASI_Mm01_00044747 predicted 463
7 SASI_Mm01_00044748 predicted 544
8 SASI_Mm01_00044749 predicted 862
9 SASI_Mm01_00044750 predicted 392
10 SASI_Mm01_00044751 predicted 1158
11 SASI_Mm01_00044752 predicted 1176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053008
OLIG3 MISSION shRNA Bacterial Glycerol Stock
oligodendrocyte transcription factor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053008.1-1733s1c1
Sequence:CCGGGCACAGAGATTCACACTCAATCTCGAGATTGAGTGTGAATCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-726s1c1
Sequence:CCGGCCTGCCGACCATTGGCACCATCTCGAGATGGTGCCAATGGTCGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-213s1c1
Sequence:CCGGCCATCAGGAGAGTCGTCTGAACTCGAGTTCAGACGACTCTCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-879s1c1
Sequence:CCGGCGCTCTCTCCACCGCCAACATCTCGAGATGTTGGCGGTGGAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-375s1c1
Sequence:CCGGGCTGAAGATCAACGGACGCGACTCGAGTCGCGTCCGTTGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-225s21c1
Sequence:CCGGGGGCGATATGGTCCAGAAGATCTCGAGATCTTCTGGACCATATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-518s21c1
Sequence:CCGGAGGAGATGAAGAGGTTGGTTGCTCGAGCAACCAACCTCTTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053008.2-1349s21c1
Sequence:CCGGCATCGAGCTAGATACACTTATCTCGAGATAAGTGTATCTAGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-138s21c1
Sequence:CCGGCATGGATGAGATGTACCTAAGCTCGAGCTTAGGTACATCTCATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-469s21c1
Sequence:CCGGACTCTGCTTCTGGCCAGAAACCTCGAGGTTTCTGGCCAGAAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053008
OLIG3 MISSION shRNA shRNA Plasmid DNA
oligodendrocyte transcription factor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053008.1-1733s1c1
Sequence:CCGGGCACAGAGATTCACACTCAATCTCGAGATTGAGTGTGAATCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-726s1c1
Sequence:CCGGCCTGCCGACCATTGGCACCATCTCGAGATGGTGCCAATGGTCGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-213s1c1
Sequence:CCGGCCATCAGGAGAGTCGTCTGAACTCGAGTTCAGACGACTCTCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-879s1c1
Sequence:CCGGCGCTCTCTCCACCGCCAACATCTCGAGATGTTGGCGGTGGAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-375s1c1
Sequence:CCGGGCTGAAGATCAACGGACGCGACTCGAGTCGCGTCCGTTGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-225s21c1
Sequence:CCGGGGGCGATATGGTCCAGAAGATCTCGAGATCTTCTGGACCATATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-518s21c1
Sequence:CCGGAGGAGATGAAGAGGTTGGTTGCTCGAGCAACCAACCTCTTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053008.2-1349s21c1
Sequence:CCGGCATCGAGCTAGATACACTTATCTCGAGATAAGTGTATCTAGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-138s21c1
Sequence:CCGGCATGGATGAGATGTACCTAAGCTCGAGCTTAGGTACATCTCATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-469s21c1
Sequence:CCGGACTCTGCTTCTGGCCAGAAACCTCGAGGTTTCTGGCCAGAAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053008
OLIG3 MISSION shRNA Lentiviral Transduction Particles
oligodendrocyte transcription factor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053008.1-1733s1c1
Sequence:CCGGGCACAGAGATTCACACTCAATCTCGAGATTGAGTGTGAATCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-726s1c1
Sequence:CCGGCCTGCCGACCATTGGCACCATCTCGAGATGGTGCCAATGGTCGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-213s1c1
Sequence:CCGGCCATCAGGAGAGTCGTCTGAACTCGAGTTCAGACGACTCTCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-879s1c1
Sequence:CCGGCGCTCTCTCCACCGCCAACATCTCGAGATGTTGGCGGTGGAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053008.1-375s1c1
Sequence:CCGGGCTGAAGATCAACGGACGCGACTCGAGTCGCGTCCGTTGATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-225s21c1
Sequence:CCGGGGGCGATATGGTCCAGAAGATCTCGAGATCTTCTGGACCATATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-518s21c1
Sequence:CCGGAGGAGATGAAGAGGTTGGTTGCTCGAGCAACCAACCTCTTCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053008.2-1349s21c1
Sequence:CCGGCATCGAGCTAGATACACTTATCTCGAGATAAGTGTATCTAGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-138s21c1
Sequence:CCGGCATGGATGAGATGTACCTAAGCTCGAGCTTAGGTACATCTCATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053008.2-469s21c1
Sequence:CCGGACTCTGCTTCTGGCCAGAAACCTCGAGGTTTCTGGCCAGAAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175747
OLIG3 MISSION shRNA Bacterial Glycerol Stock
oligodendrocyte transcription factor 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-983s1c1
Sequence:CCGGCGCTCTCTCCACAGCCAACATCTCGAGATGTTGGCTGTGGAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-353s1c1
Sequence:CCGGGCAGGGCGATATGATGCAGAACTCGAGTTCTGCATCATATCGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-1019s1c1
Sequence:CCGGCGAGTCCAAGGACTTGCTCAACTCGAGTTGAGCAAGTCCTTGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-413s1c1
Sequence:CCGGCGCGGGAGAGAGCAGCAAGTACTCGAGTACTTGCTGCTCTCTCCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-611s1c1
Sequence:CCGGCGCCAGAAACTACATCCTCATCTCGAGATGAGGATGTAGTTTCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175747.2-1424s21c1
Sequence:CCGGTGACTCTGTGTTCTCGCTTTGCTCGAGCAAAGCGAGAACACAGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175747.2-1370s21c1
Sequence:CCGGGATGGGATCGGTGTAGTTAAACTCGAGTTTAACTACACCGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175747
OLIG3 MISSION shRNA shRNA Plasmid DNA
oligodendrocyte transcription factor 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-983s1c1
Sequence:CCGGCGCTCTCTCCACAGCCAACATCTCGAGATGTTGGCTGTGGAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-353s1c1
Sequence:CCGGGCAGGGCGATATGATGCAGAACTCGAGTTCTGCATCATATCGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-1019s1c1
Sequence:CCGGCGAGTCCAAGGACTTGCTCAACTCGAGTTGAGCAAGTCCTTGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-413s1c1
Sequence:CCGGCGCGGGAGAGAGCAGCAAGTACTCGAGTACTTGCTGCTCTCTCCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-611s1c1
Sequence:CCGGCGCCAGAAACTACATCCTCATCTCGAGATGAGGATGTAGTTTCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175747.2-1424s21c1
Sequence:CCGGTGACTCTGTGTTCTCGCTTTGCTCGAGCAAAGCGAGAACACAGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175747.2-1370s21c1
Sequence:CCGGGATGGGATCGGTGTAGTTAAACTCGAGTTTAACTACACCGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175747
OLIG3 MISSION shRNA Lentiviral Transduction Particles
oligodendrocyte transcription factor 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-983s1c1
Sequence:CCGGCGCTCTCTCCACAGCCAACATCTCGAGATGTTGGCTGTGGAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-353s1c1
Sequence:CCGGGCAGGGCGATATGATGCAGAACTCGAGTTCTGCATCATATCGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-1019s1c1
Sequence:CCGGCGAGTCCAAGGACTTGCTCAACTCGAGTTGAGCAAGTCCTTGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-413s1c1
Sequence:CCGGCGCGGGAGAGAGCAGCAAGTACTCGAGTACTTGCTGCTCTCTCCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175747.2-611s1c1
Sequence:CCGGCGCCAGAAACTACATCCTCATCTCGAGATGAGGATGTAGTTTCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175747.2-1424s21c1
Sequence:CCGGTGACTCTGTGTTCTCGCTTTGCTCGAGCAAAGCGAGAACACAGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175747.2-1370s21c1
Sequence:CCGGGATGGGATCGGTGTAGTTAAACTCGAGTTTAACTACACCGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks