EMAIL THIS PAGE TO A FRIEND

OPTC

opticin

Synonyms: OPT
UniProtKB ID: Q9UBM4, Q5T2G4
Gene ID:
Human(26254) Summary: Opticin belongs to class III of the small leucine-rich repeat protein (SLRP) family. Members of this family are typically associated with the extracellular matrix. Opticin is present in significant quantities in the vitreous of the eye and also localizes to the cornea, iris, ciliary body, optic nerve, choroid, retina, and fetal liver. Opticin may noncovalently bind collagen fibrils and regulate fibril morphology, spacing, and organization. The opticin gene is mapped to a region of chromosome 1 that is associated with the inherited eye diseases age-related macular degeneration (AMD) and posterior column ataxia with retinosa pigmentosa (AXPC1). [provided by RefSeq, Jul 2008]
Mouse(269120) opticin
Rat(304802) opticin
cow(404034) opticin
dog(403591) opticin
chicken(395130) opticin
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014359 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138641 MISSION® esiRNA esiRNA human OPTC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014359 Rosetta Predictions human pricing
NM_001107176 Rosetta Predictions rat pricing
NM_054076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049764 predicted 537
2 SASI_Hs01_00049765 predicted 780
3 SASI_Hs01_00049766 predicted 515
4 SASI_Hs01_00049767 predicted 1132
5 SASI_Hs01_00049768 predicted 228
6 SASI_Hs01_00049769 predicted 623
7 SASI_Hs01_00049770 predicted 611
8 SASI_Hs01_00049771 predicted 611
9 SASI_Hs01_00049772 predicted 1157
10 SASI_Hs01_00049773 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226255 predicted 791
2 SASI_Rn02_00226256 predicted 754
3 SASI_Rn02_00226257 predicted 635
4 SASI_Rn02_00226258 predicted 691
5 SASI_Rn02_00226259 predicted 782
6 SASI_Rn02_00226260 predicted 998
7 SASI_Rn02_00226261 predicted 760
8 SASI_Rn02_00226262 predicted 1003
9 SASI_Rn02_00226263 predicted 694
10 SASI_Rn02_00226264 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167981 predicted 990
2 SASI_Mm01_00167982 predicted 1018
3 SASI_Mm01_00167983 predicted 593
4 SASI_Mm01_00167984 predicted 398
5 SASI_Mm01_00167985 predicted 437
6 SASI_Mm01_00167986 predicted 495
7 SASI_Mm01_00167987 predicted 665
8 SASI_Mm01_00167988 predicted 659
9 SASI_Mm01_00167989 predicted 1121
10 SASI_Mm01_00167990 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014359
OPTC MISSION shRNA Bacterial Glycerol Stock
opticin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-635s1c1
Sequence:CCGGCAAAGGGCTGACAAAGTTGAACTCGAGTTCAACTTTGTCAGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-944s1c1
Sequence:CCGGGAATAACCTGATAGAGACCATCTCGAGATGGTCTCTATCAGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-231s1c1
Sequence:CCGGGATTCCTTTGAAGTTCTGCCTCTCGAGAGGCAGAACTTCAAAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-524s1c1
Sequence:CCGGCTCTGTGTATTGCGATGACATCTCGAGATGTCATCGCAATACACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-291s1c1
Sequence:CCGGGTCATTGACCTGAGCAACTATCTCGAGATAGTTGCTCAGGTCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-685s1c1
Sequence:CCGGCCTCCATCGATAATGATGCCTCTCGAGAGGCATCATTATCGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-549s1c1
Sequence:CCGGCTAGAGGACATTCCTCCTCTTCTCGAGAAGAGGAGGAATGTCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-659s1c1
Sequence:CCGGGATTGACCTCTCCAACAACCTCTCGAGAGGTTGTTGGAGAGGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-536s1c1
Sequence:CCGGCGATGACATTGACCTAGAGGACTCGAGTCCTCTAGGTCAATGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-869s1c1
Sequence:CCGGCCTTTACCTGTCAGACAACCTCTCGAGAGGTTGTCTGACAGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014359
OPTC MISSION shRNA shRNA Plasmid DNA
opticin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-635s1c1
Sequence:CCGGCAAAGGGCTGACAAAGTTGAACTCGAGTTCAACTTTGTCAGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-944s1c1
Sequence:CCGGGAATAACCTGATAGAGACCATCTCGAGATGGTCTCTATCAGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-231s1c1
Sequence:CCGGGATTCCTTTGAAGTTCTGCCTCTCGAGAGGCAGAACTTCAAAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-524s1c1
Sequence:CCGGCTCTGTGTATTGCGATGACATCTCGAGATGTCATCGCAATACACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-291s1c1
Sequence:CCGGGTCATTGACCTGAGCAACTATCTCGAGATAGTTGCTCAGGTCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-685s1c1
Sequence:CCGGCCTCCATCGATAATGATGCCTCTCGAGAGGCATCATTATCGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-549s1c1
Sequence:CCGGCTAGAGGACATTCCTCCTCTTCTCGAGAAGAGGAGGAATGTCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-659s1c1
Sequence:CCGGGATTGACCTCTCCAACAACCTCTCGAGAGGTTGTTGGAGAGGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-536s1c1
Sequence:CCGGCGATGACATTGACCTAGAGGACTCGAGTCCTCTAGGTCAATGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-869s1c1
Sequence:CCGGCCTTTACCTGTCAGACAACCTCTCGAGAGGTTGTCTGACAGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014359
OPTC MISSION shRNA Lentiviral Transduction Particles
opticin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-635s1c1
Sequence:CCGGCAAAGGGCTGACAAAGTTGAACTCGAGTTCAACTTTGTCAGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-944s1c1
Sequence:CCGGGAATAACCTGATAGAGACCATCTCGAGATGGTCTCTATCAGGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-231s1c1
Sequence:CCGGGATTCCTTTGAAGTTCTGCCTCTCGAGAGGCAGAACTTCAAAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-524s1c1
Sequence:CCGGCTCTGTGTATTGCGATGACATCTCGAGATGTCATCGCAATACACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-291s1c1
Sequence:CCGGGTCATTGACCTGAGCAACTATCTCGAGATAGTTGCTCAGGTCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-685s1c1
Sequence:CCGGCCTCCATCGATAATGATGCCTCTCGAGAGGCATCATTATCGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-549s1c1
Sequence:CCGGCTAGAGGACATTCCTCCTCTTCTCGAGAAGAGGAGGAATGTCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014359.2-659s1c1
Sequence:CCGGGATTGACCTCTCCAACAACCTCTCGAGAGGTTGTTGGAGAGGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-536s1c1
Sequence:CCGGCGATGACATTGACCTAGAGGACTCGAGTCCTCTAGGTCAATGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014359.2-869s1c1
Sequence:CCGGCCTTTACCTGTCAGACAACCTCTCGAGAGGTTGTCTGACAGGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054076
OPTC MISSION shRNA Bacterial Glycerol Stock
opticin
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054076.1-441s1c1
Sequence:CCGGCCTGAGCATAGAGGACTACAACTCGAGTTGTAGTCCTCTATGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054076.1-1632s1c1
Sequence:CCGGCCAGGAGAACCATGAAAGAAACTCGAGTTTCTTTCATGGTTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054076.1-1107s1c1
Sequence:CCGGCCTGCAGAATAACATGATCGACTCGAGTCGATCATGTTATTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054076.1-1113s1c1
Sequence:CCGGGAATAACATGATCGAGACCATCTCGAGATGGTCTCGATCATGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054076
OPTC MISSION shRNA shRNA Plasmid DNA
opticin
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054076.1-441s1c1
Sequence:CCGGCCTGAGCATAGAGGACTACAACTCGAGTTGTAGTCCTCTATGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054076.1-1632s1c1
Sequence:CCGGCCAGGAGAACCATGAAAGAAACTCGAGTTTCTTTCATGGTTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054076.1-1107s1c1
Sequence:CCGGCCTGCAGAATAACATGATCGACTCGAGTCGATCATGTTATTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054076.1-1113s1c1
Sequence:CCGGGAATAACATGATCGAGACCATCTCGAGATGGTCTCGATCATGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054076
OPTC MISSION shRNA Lentiviral Transduction Particles
opticin
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054076.1-441s1c1
Sequence:CCGGCCTGAGCATAGAGGACTACAACTCGAGTTGTAGTCCTCTATGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054076.1-1632s1c1
Sequence:CCGGCCAGGAGAACCATGAAAGAAACTCGAGTTTCTTTCATGGTTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054076.1-1107s1c1
Sequence:CCGGCCTGCAGAATAACATGATCGACTCGAGTCGATCATGTTATTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054076.1-1113s1c1
Sequence:CCGGGAATAACATGATCGAGACCATCTCGAGATGGTCTCGATCATGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks