EMAIL THIS PAGE TO A FRIEND

OPTN

optineurin

Synonyms: ALS12 FIP2 GLC1E HIP7 HYPL NRP TFIIIA-INTP
Gene ID:
Human(10133) Summary: This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(71648) optineurin
Rat(246294) optineurin
Zebrafish(336159) optineurin
chicken(374079) optineurin
dog(478003) optineurin
cow(534150) optineurin
sheep(101106703) optineurin
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181848 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181848 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181848 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021980 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077201 MISSION® esiRNA esiRNA human OPTN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008211 Rosetta Predictions human pricing
NM_001008212 Rosetta Predictions human pricing
NM_001008213 Rosetta Predictions human pricing
NM_021980 Rosetta Predictions human pricing
NM_145081 Rosetta Predictions rat pricing
NM_181848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149664 predicted 746
2 SASI_Hs01_00149665 predicted 643
3 SASI_Hs01_00149666 predicted 1222
4 SASI_Hs01_00149667 predicted 1115
5 SASI_Hs01_00149668 predicted 1548
6 SASI_Hs01_00149669 predicted 1253
7 SASI_Hs01_00149670 predicted 1262
8 SASI_Hs01_00149671 predicted 1526
9 SASI_Hs01_00149672 predicted 1194
10 SASI_Hs01_00149673 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305366 predicted 1784
2 SASI_Hs01_00100163 predicted 1149
3 SASI_Hs01_00100164 predicted 1043
4 SASI_Hs01_00100165 predicted 1475
5 SASI_Hs01_00100166 predicted 1183
6 SASI_Hs01_00100167 predicted 1192
7 SASI_Hs01_00100169 predicted 1461
8 SASI_Hs01_00100170 predicted 1121
9 SASI_Hs01_00100171 predicted 825
10 SASI_Hs02_00305367 predicted 612
11 SASI_Hs01_00100162 predicted 680
12 SASI_Hs01_00100168 predicted 2031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044994 predicted 1837
2 SASI_Hs01_00044996 predicted 1204
3 SASI_Hs01_00044997 predicted 1098
4 SASI_Hs01_00044998 predicted 1528
5 SASI_Hs01_00044999 predicted 1231
6 SASI_Hs02_00305368 predicted 1242
7 SASI_Hs01_00045000 predicted 1512
8 SASI_Hs01_00045001 predicted 1182
9 SASI_Hs01_00045002 predicted 876
10 SASI_Hs01_00045003 predicted 674
11 SASI_Hs01_00044995 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047255 predicted 1624
2 SASI_Hs01_00047257 predicted 1001
3 SASI_Hs01_00047258 predicted 892
4 SASI_Hs01_00047259 predicted 1325
5 SASI_Hs01_00047260 predicted 1030
6 SASI_Hs02_00355339 predicted 1042
7 SASI_Hs01_00047261 predicted 1309
8 SASI_Hs01_00047262 predicted 975
9 SASI_Hs01_00047263 predicted 670
10 SASI_Hs01_00047264 predicted 468
11 SASI_Hs01_00047256 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268655 predicted 1812
2 SASI_Rn01_00042502 predicted 624
3 SASI_Rn01_00042504 predicted 375
4 SASI_Rn01_00042505 predicted 256
5 SASI_Rn01_00042506 predicted 971
6 SASI_Rn01_00042508 predicted 1735
7 SASI_Rn01_00042509 predicted 1233
8 SASI_Rn01_00042510 predicted 223
9 SASI_Rn01_00042511 predicted 1535
10 SASI_Rn02_00268656 predicted 919
11 SASI_Rn01_00042503 predicted 1561
12 SASI_Rn01_00042507 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172859 predicted 978
2 SASI_Mm01_00172860 predicted 292
3 SASI_Mm01_00172861 predicted 1224
4 SASI_Mm01_00172862 predicted 206
5 SASI_Mm01_00172863 predicted 852
6 SASI_Mm01_00172864 predicted 316
7 SASI_Mm01_00172865 predicted 1857
8 SASI_Mm01_00172866 predicted 325
9 SASI_Mm01_00172867 predicted 1643
10 SASI_Mm02_00349936 predicted 971
11 SASI_Mm01_00172868 predicted 1554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181848
VALIDATED
OPTN MISSION shRNA Bacterial Glycerol Stock
optineurin
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181848.3-766s1c1
Sequence:CCGGGCTTTGCCTAAGGGAAGGAAACTCGAGTTTCCTTCCCTTAGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181848.3-1022s1c1
Sequence:CCGGGAGCTGATGAAGAAGAGACTTCTCGAGAAGTCTCTTCTTCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181848.3-1550s1c1
Sequence:CCGGCTGAAAGAGAACAATGACATTCTCGAGAATGTCATTGTTCTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181848.3-291s1c1
Sequence:CCGGGCCTGTTGTTTGAGATGCAAACTCGAGTTTGCATCTCAAACAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181848.3-1851s1c1
Sequence:CCGGGAAGTCACAAAGAGGAATCTACTCGAGTAGATTCCTCTTTGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181848.3-2079s1c1
Sequence:CCGGGATAGGGACAAGCTCAGGATTCTCGAGAATCCTGAGCTTGTCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181848
VALIDATED
OPTN MISSION shRNA shRNA Plasmid DNA
optineurin
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181848.3-766s1c1
Sequence:CCGGGCTTTGCCTAAGGGAAGGAAACTCGAGTTTCCTTCCCTTAGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181848.3-1022s1c1
Sequence:CCGGGAGCTGATGAAGAAGAGACTTCTCGAGAAGTCTCTTCTTCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181848.3-1550s1c1
Sequence:CCGGCTGAAAGAGAACAATGACATTCTCGAGAATGTCATTGTTCTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181848.3-291s1c1
Sequence:CCGGGCCTGTTGTTTGAGATGCAAACTCGAGTTTGCATCTCAAACAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181848.3-1851s1c1
Sequence:CCGGGAAGTCACAAAGAGGAATCTACTCGAGTAGATTCCTCTTTGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181848.3-2079s1c1
Sequence:CCGGGATAGGGACAAGCTCAGGATTCTCGAGAATCCTGAGCTTGTCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181848
VALIDATED
OPTN MISSION shRNA Lentiviral Transduction Particles
optineurin
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181848.3-766s1c1
Sequence:CCGGGCTTTGCCTAAGGGAAGGAAACTCGAGTTTCCTTCCCTTAGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181848.3-1022s1c1
Sequence:CCGGGAGCTGATGAAGAAGAGACTTCTCGAGAAGTCTCTTCTTCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181848.3-1550s1c1
Sequence:CCGGCTGAAAGAGAACAATGACATTCTCGAGAATGTCATTGTTCTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181848.3-291s1c1
Sequence:CCGGGCCTGTTGTTTGAGATGCAAACTCGAGTTTGCATCTCAAACAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181848.3-1851s1c1
Sequence:CCGGGAAGTCACAAAGAGGAATCTACTCGAGTAGATTCCTCTTTGTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200426    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181848.3-2079s1c1
Sequence:CCGGGATAGGGACAAGCTCAGGATTCTCGAGAATCCTGAGCTTGTCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021980
OPTN MISSION shRNA Bacterial Glycerol Stock
optineurin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-314s1c1
Sequence:CCGGGCCATGAAGCTAAATAATCAACTCGAGTTGATTATTTAGCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-1634s1c1
Sequence:CCGGGCAGTTCTGCTGAAAGAGAATCTCGAGATTCTCTTTCAGCAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-1858s1c1
Sequence:CCGGCGTGATGGATTGCATCATTTACTCGAGTAAATGATGCAATCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-809s1c1
Sequence:CCGGGCCAAGAATTACTTCGAACATCTCGAGATGTTCGAAGTAATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-768s1c1
Sequence:CCGGGCACGGCATTGTCTAAATATACTCGAGTATATTTAGACAATGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021980.4-1039s21c1
Sequence:CCGGTAATCGTTCTGAGATTGAAACCTCGAGGTTTCAATCTCAGAACGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021980.4-318s21c1
Sequence:CCGGACCCAAACCTGGACACGTTTACTCGAGTAAACGTGTCCAGGTTTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021980
OPTN MISSION shRNA shRNA Plasmid DNA
optineurin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-314s1c1
Sequence:CCGGGCCATGAAGCTAAATAATCAACTCGAGTTGATTATTTAGCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-1634s1c1
Sequence:CCGGGCAGTTCTGCTGAAAGAGAATCTCGAGATTCTCTTTCAGCAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-1858s1c1
Sequence:CCGGCGTGATGGATTGCATCATTTACTCGAGTAAATGATGCAATCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-809s1c1
Sequence:CCGGGCCAAGAATTACTTCGAACATCTCGAGATGTTCGAAGTAATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-768s1c1
Sequence:CCGGGCACGGCATTGTCTAAATATACTCGAGTATATTTAGACAATGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021980.4-1039s21c1
Sequence:CCGGTAATCGTTCTGAGATTGAAACCTCGAGGTTTCAATCTCAGAACGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021980.4-318s21c1
Sequence:CCGGACCCAAACCTGGACACGTTTACTCGAGTAAACGTGTCCAGGTTTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021980
OPTN MISSION shRNA Lentiviral Transduction Particles
optineurin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-314s1c1
Sequence:CCGGGCCATGAAGCTAAATAATCAACTCGAGTTGATTATTTAGCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-1634s1c1
Sequence:CCGGGCAGTTCTGCTGAAAGAGAATCTCGAGATTCTCTTTCAGCAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-1858s1c1
Sequence:CCGGCGTGATGGATTGCATCATTTACTCGAGTAAATGATGCAATCCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-809s1c1
Sequence:CCGGGCCAAGAATTACTTCGAACATCTCGAGATGTTCGAAGTAATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021980.3-768s1c1
Sequence:CCGGGCACGGCATTGTCTAAATATACTCGAGTATATTTAGACAATGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021980.4-1039s21c1
Sequence:CCGGTAATCGTTCTGAGATTGAAACCTCGAGGTTTCAATCTCAGAACGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021980.4-318s21c1
Sequence:CCGGACCCAAACCTGGACACGTTTACTCGAGTAAACGTGTCCAGGTTTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks