EMAIL THIS PAGE TO A FRIEND

OR10A3

olfactory receptor, family 10, subfamily A, member 3

Synonyms: HSHTPCRX12 HTPCRX12
UniProtKB ID: P58181, B9EH39, Q6IF58, Q96R11
Gene ID:
Human(26496) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(782766) olfactory receptor, family 10, subfamily A, member 3
dog(611322) olfactory receptor, family 10, subfamily A, member 3
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302483 ANTI-OR10A3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291986 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121061 MISSION® esiRNA esiRNA human OR10A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003745 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162946 predicted 588
2 SASI_Hs01_00162947 predicted 569
3 SASI_Hs01_00162948 predicted 473
4 SASI_Hs01_00162949 predicted 423
5 SASI_Hs01_00162950 predicted 469
6 SASI_Hs01_00162951 predicted 383
7 SASI_Hs01_00162952 predicted 466
8 SASI_Hs01_00162953 predicted 203
9 SASI_Hs01_00162954 predicted 558
10 SASI_Hs01_00162955 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291986
OR10A3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily A, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-568s1c1
Sequence:CCGGGCAGACACCTTCTTATTTGAACTCGAGTTCAAATAAGAAGGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-298s1c1
Sequence:CCGGCAGATGTATTTCATCCTTCTTCTCGAGAAGAAGGATGAAATACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-221s1c1
Sequence:CCGGGTGCAGTCATTACGCCTGAAACTCGAGTTTCAGGCGTAATGACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-385s1c1
Sequence:CCGGCCTCTGAACTACCCAGTGATTCTCGAGAATCACTGGGTAGTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-114s1c1
Sequence:CCGGCCTGATGGGAAATGCCATCATCTCGAGATGATGGCATTTCCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291986
OR10A3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily A, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-568s1c1
Sequence:CCGGGCAGACACCTTCTTATTTGAACTCGAGTTCAAATAAGAAGGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-298s1c1
Sequence:CCGGCAGATGTATTTCATCCTTCTTCTCGAGAAGAAGGATGAAATACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-221s1c1
Sequence:CCGGGTGCAGTCATTACGCCTGAAACTCGAGTTTCAGGCGTAATGACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-385s1c1
Sequence:CCGGCCTCTGAACTACCCAGTGATTCTCGAGAATCACTGGGTAGTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-114s1c1
Sequence:CCGGCCTGATGGGAAATGCCATCATCTCGAGATGATGGCATTTCCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291986
OR10A3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily A, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-568s1c1
Sequence:CCGGGCAGACACCTTCTTATTTGAACTCGAGTTCAAATAAGAAGGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-298s1c1
Sequence:CCGGCAGATGTATTTCATCCTTCTTCTCGAGAAGAAGGATGAAATACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-221s1c1
Sequence:CCGGGTGCAGTCATTACGCCTGAAACTCGAGTTTCAGGCGTAATGACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-385s1c1
Sequence:CCGGCCTCTGAACTACCCAGTGATTCTCGAGAATCACTGGGTAGTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291986.3-114s1c1
Sequence:CCGGCCTGATGGGAAATGCCATCATCTCGAGATGATGGCATTTCCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks