EMAIL THIS PAGE TO A FRIEND

OR10H1

olfactory receptor, family 10, subfamily H, member 1

UniProtKB ID: Q9Y4A9, Q6IFQ2, Q96R59
Gene ID:
Human(26539) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(508140) olfactory receptor, family 10, subfamily H, member 1
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013940 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153141 MISSION® esiRNA esiRNA human OR10H1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013940 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344877 predicted 1051
2 SASI_Hs02_00344878 predicted 1026
3 SASI_Hs01_00237425 predicted 21
4 SASI_Hs01_00237426 predicted 904
5 SASI_Hs01_00237427 predicted 909
6 SASI_Hs01_00237428 predicted 926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013940
OR10H1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily H, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-771s1c1
Sequence:CCGGCGTCATTTACCTGAAGCCCAACTCGAGTTGGGCTTCAGGTAAATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-300s1c1
Sequence:CCGGGATGTTCTTCTCCTTCAGCTTCTCGAGAAGCTGAAGGAGAAGAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-495s1c1
Sequence:CCGGCCTCGCCTTCTGTGGACACAACTCGAGTTGTGTCCACAGAAGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-673s1c1
Sequence:CCGGGCCATCTTGAAGATCCCTTCTCTCGAGAGAAGGGATCTTCAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-90s1c1
Sequence:CCGGGTTCCTGCTGATGTACCTGTTCTCGAGAACAGGTACATCAGCAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-599s21c1
Sequence:CCGGACACAAGGAGATCCACCATTTCTCGAGAAATGGTGGATCTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-848s21c1
Sequence:CCGGTGGCTTTGCCTCCGTCATTTACTCGAGTAAATGACGGAGGCAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-478s21c1
Sequence:CCGGTGCGCTACAACGTGCTCATGACTCGAGTCATGAGCACGTTGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-780s21c1
Sequence:CCGGTCTGCTGAAGGTCGGAACAAGCTCGAGCTTGTTCCGACCTTCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013940
OR10H1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily H, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-771s1c1
Sequence:CCGGCGTCATTTACCTGAAGCCCAACTCGAGTTGGGCTTCAGGTAAATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-300s1c1
Sequence:CCGGGATGTTCTTCTCCTTCAGCTTCTCGAGAAGCTGAAGGAGAAGAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-495s1c1
Sequence:CCGGCCTCGCCTTCTGTGGACACAACTCGAGTTGTGTCCACAGAAGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-673s1c1
Sequence:CCGGGCCATCTTGAAGATCCCTTCTCTCGAGAGAAGGGATCTTCAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-90s1c1
Sequence:CCGGGTTCCTGCTGATGTACCTGTTCTCGAGAACAGGTACATCAGCAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-599s21c1
Sequence:CCGGACACAAGGAGATCCACCATTTCTCGAGAAATGGTGGATCTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-848s21c1
Sequence:CCGGTGGCTTTGCCTCCGTCATTTACTCGAGTAAATGACGGAGGCAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-478s21c1
Sequence:CCGGTGCGCTACAACGTGCTCATGACTCGAGTCATGAGCACGTTGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-780s21c1
Sequence:CCGGTCTGCTGAAGGTCGGAACAAGCTCGAGCTTGTTCCGACCTTCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013940
OR10H1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily H, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-771s1c1
Sequence:CCGGCGTCATTTACCTGAAGCCCAACTCGAGTTGGGCTTCAGGTAAATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-300s1c1
Sequence:CCGGGATGTTCTTCTCCTTCAGCTTCTCGAGAAGCTGAAGGAGAAGAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-495s1c1
Sequence:CCGGCCTCGCCTTCTGTGGACACAACTCGAGTTGTGTCCACAGAAGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-673s1c1
Sequence:CCGGGCCATCTTGAAGATCCCTTCTCTCGAGAGAAGGGATCTTCAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013940.1-90s1c1
Sequence:CCGGGTTCCTGCTGATGTACCTGTTCTCGAGAACAGGTACATCAGCAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-599s21c1
Sequence:CCGGACACAAGGAGATCCACCATTTCTCGAGAAATGGTGGATCTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-848s21c1
Sequence:CCGGTGGCTTTGCCTCCGTCATTTACTCGAGTAAATGACGGAGGCAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-478s21c1
Sequence:CCGGTGCGCTACAACGTGCTCATGACTCGAGTCATGAGCACGTTGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013940.2-780s21c1
Sequence:CCGGTCTGCTGAAGGTCGGAACAAGCTCGAGCTTGTTCCGACCTTCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks