EMAIL THIS PAGE TO A FRIEND

OR10H2

olfactory receptor, family 10, subfamily H, member 2

Species: Human OR10H2(26538)
UniProtKB ID: O60403, Q6IFQ1, Q96R58
Gene ID:
Human(26538) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501148 Anti-OR10H2, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013939 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150931 MISSION® esiRNA esiRNA human OR10H2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013939 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030665 predicted 617
2 SASI_Hs01_00030666 predicted 579
3 SASI_Hs01_00030667 predicted 741
4 SASI_Hs01_00030672 predicted 756
5 SASI_Hs01_00030668 predicted 514
6 SASI_Hs02_00344875 predicted 742
7 SASI_Hs01_00030669 predicted 582
8 SASI_Hs01_00030670 predicted 504
9 SASI_Hs01_00030671 predicted 927
10 SASI_Hs02_00344876 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013939
OR10H2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily H, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-518s21c1
Sequence:CCGGGACTTTCTGTGGATCCCATGACTCGAGTCATGGGATCCACAGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-741s21c1
Sequence:CCGGACCTGTGCCTCTCACCTTATTCTCGAGAATAAGGTGAGAGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-585s21c1
Sequence:CCGGTGTGGAAATAATGTACCAGCTCTCGAGAGCTGGTACATTATTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-766s21c1
Sequence:CCGGTCATTGTGCACTATGGCTTTGCTCGAGCAAAGCCATAGTGCACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-730s1c1
Sequence:CCGGTCTCACCTTATTGTGGTCATTCTCGAGAATGACCACAATAAGGTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-562s1c1
Sequence:CCGGGCCTGTGGAAATAATGTACCACTCGAGTGGTACATTATTTCCACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-671s1c1
Sequence:CCGGCCGACATCTTGAAGATCCCTTCTCGAGAAGGGATCTTCAAGATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-293s1c1
Sequence:CCGGCCAGTCAGATGTTCTTCTCCTCTCGAGAGGAGAAGAACATCTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-491s1c1
Sequence:CCGGTCCAACTGACTTTCTGTGGATCTCGAGATCCACAGAAAGTCAGTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013939
OR10H2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily H, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-518s21c1
Sequence:CCGGGACTTTCTGTGGATCCCATGACTCGAGTCATGGGATCCACAGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-741s21c1
Sequence:CCGGACCTGTGCCTCTCACCTTATTCTCGAGAATAAGGTGAGAGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-585s21c1
Sequence:CCGGTGTGGAAATAATGTACCAGCTCTCGAGAGCTGGTACATTATTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-766s21c1
Sequence:CCGGTCATTGTGCACTATGGCTTTGCTCGAGCAAAGCCATAGTGCACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-730s1c1
Sequence:CCGGTCTCACCTTATTGTGGTCATTCTCGAGAATGACCACAATAAGGTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-562s1c1
Sequence:CCGGGCCTGTGGAAATAATGTACCACTCGAGTGGTACATTATTTCCACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-671s1c1
Sequence:CCGGCCGACATCTTGAAGATCCCTTCTCGAGAAGGGATCTTCAAGATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-293s1c1
Sequence:CCGGCCAGTCAGATGTTCTTCTCCTCTCGAGAGGAGAAGAACATCTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-491s1c1
Sequence:CCGGTCCAACTGACTTTCTGTGGATCTCGAGATCCACAGAAAGTCAGTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013939
OR10H2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily H, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-518s21c1
Sequence:CCGGGACTTTCTGTGGATCCCATGACTCGAGTCATGGGATCCACAGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-741s21c1
Sequence:CCGGACCTGTGCCTCTCACCTTATTCTCGAGAATAAGGTGAGAGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-585s21c1
Sequence:CCGGTGTGGAAATAATGTACCAGCTCTCGAGAGCTGGTACATTATTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013939.2-766s21c1
Sequence:CCGGTCATTGTGCACTATGGCTTTGCTCGAGCAAAGCCATAGTGCACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-730s1c1
Sequence:CCGGTCTCACCTTATTGTGGTCATTCTCGAGAATGACCACAATAAGGTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-562s1c1
Sequence:CCGGGCCTGTGGAAATAATGTACCACTCGAGTGGTACATTATTTCCACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-671s1c1
Sequence:CCGGCCGACATCTTGAAGATCCCTTCTCGAGAAGGGATCTTCAAGATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-293s1c1
Sequence:CCGGCCAGTCAGATGTTCTTCTCCTCTCGAGAGGAGAAGAACATCTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013939.1-491s1c1
Sequence:CCGGTCCAACTGACTTTCTGTGGATCTCGAGATCCACAGAAAGTCAGTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks