EMAIL THIS PAGE TO A FRIEND

OR10J5

olfactory receptor, family 10, subfamily J, member 5

Synonyms: OR1-28
UniProtKB ID: Q8NHC4, B9EH35, Q6IFH2
Gene ID:
Human(127385) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(508986) olfactory receptor, family 10, subfamily J, member 5
dog(488627) olfactory receptor, family 10, subfamily J, member 5
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_060458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_060458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_060458 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004469 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141299 predicted 623
2 SASI_Hs01_00141301 predicted 562
3 SASI_Hs01_00141303 predicted 323
4 SASI_Hs01_00141304 predicted 531
5 SASI_Hs01_00141307 predicted 625
6 SASI_Hs02_00304603 predicted 498
7 SASI_Hs02_00304604 predicted 544
8 SASI_Hs02_00304605 predicted 511
9 SASI_Hs02_00304606 predicted 495
10 SASI_Hs02_00304607 predicted 224
11 SASI_Hs01_00141298 predicted 603
12 SASI_Hs01_00141300 predicted 590
13 SASI_Hs01_00141302 predicted 285
14 SASI_Hs01_00141305 predicted 444
15 SASI_Hs01_00141306 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_060458
OR10J5 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily J, member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-387s1c1
Sequence:CCGGCCTGAGATACACTGTCATCATCTCGAGATGATGACAGTGTATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-443s1c2
Sequence:CCGGCCTTTGGCATTGGTCTGACTACTCGAGTAGTCAGACCAATGCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-647s1c1
Sequence:CCGGCCTATGTCCTTGTCATCTCTTCTCGAGAAGAGATGACAAGGACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-780s1c2
Sequence:CCGGGCCGAAGTCAGAAAGTTCAATCTCGAGATTGAACTTTCTGACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-568s1c1
Sequence:CCGGGATACCACTATCAATGAGATACTCGAGTATCTCATTGATAGTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_060458
OR10J5 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily J, member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-387s1c1
Sequence:CCGGCCTGAGATACACTGTCATCATCTCGAGATGATGACAGTGTATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-443s1c2
Sequence:CCGGCCTTTGGCATTGGTCTGACTACTCGAGTAGTCAGACCAATGCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-647s1c1
Sequence:CCGGCCTATGTCCTTGTCATCTCTTCTCGAGAAGAGATGACAAGGACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-780s1c2
Sequence:CCGGGCCGAAGTCAGAAAGTTCAATCTCGAGATTGAACTTTCTGACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-568s1c1
Sequence:CCGGGATACCACTATCAATGAGATACTCGAGTATCTCATTGATAGTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_060458
OR10J5 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily J, member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-387s1c1
Sequence:CCGGCCTGAGATACACTGTCATCATCTCGAGATGATGACAGTGTATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-443s1c2
Sequence:CCGGCCTTTGGCATTGGTCTGACTACTCGAGTAGTCAGACCAATGCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-647s1c1
Sequence:CCGGCCTATGTCCTTGTCATCTCTTCTCGAGAAGAGATGACAAGGACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-780s1c2
Sequence:CCGGGCCGAAGTCAGAAAGTTCAATCTCGAGATTGAACTTTCTGACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060458.4-568s1c1
Sequence:CCGGGATACCACTATCAATGAGATACTCGAGTATCTCATTGATAGTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks