EMAIL THIS PAGE TO A FRIEND

OR11H6

olfactory receptor, family 11, subfamily H, member 6

UniProtKB ID: Q8NGC7, Q6IF08
Gene ID:
Human(122748) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(783780) olfactory receptor, family 11, subfamily H, member 6
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_063315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_063315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_063315 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135751 MISSION® esiRNA esiRNA human OR11H6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004480 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167596 predicted 638
2 SASI_Hs01_00167597 predicted 514
3 SASI_Hs01_00167599 predicted 427
4 SASI_Hs01_00167601 predicted 701
5 SASI_Hs02_00304623 predicted 623
6 SASI_Hs01_00167603 predicted 283
7 SASI_Hs02_00304624 predicted 282
8 SASI_Hs02_00304625 predicted 525
9 SASI_Hs02_00304626 predicted 618
10 SASI_Hs01_00167605 predicted 499
11 SASI_Hs01_00167598 predicted 244
12 SASI_Hs01_00167600 predicted 767
13 SASI_Hs01_00167602 predicted 518
14 SASI_Hs01_00167604 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_063315
OR11H6 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 11, subfamily H, member 6
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000189215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063315.2-109s1c1
Sequence:CCGGGTAGGCGGATTTCTCTGCTATCTCGAGATAGCAGAGAAATCCGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063315.2-171s1c1
Sequence:CCGGGCCCAACATCATTGACCACTTCTCGAGAAGTGGTCAATGATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063315.2-294s1c1
Sequence:CCGGCCTCTCCATCTTGGGATCTTACTCGAGTAAGATCCCAAGATGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_063315
OR11H6 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 11, subfamily H, member 6
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000189215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063315.2-109s1c1
Sequence:CCGGGTAGGCGGATTTCTCTGCTATCTCGAGATAGCAGAGAAATCCGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063315.2-171s1c1
Sequence:CCGGGCCCAACATCATTGACCACTTCTCGAGAAGTGGTCAATGATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063315.2-294s1c1
Sequence:CCGGCCTCTCCATCTTGGGATCTTACTCGAGTAAGATCCCAAGATGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_063315
OR11H6 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 11, subfamily H, member 6
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000189215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063315.2-109s1c1
Sequence:CCGGGTAGGCGGATTTCTCTGCTATCTCGAGATAGCAGAGAAATCCGCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063315.2-171s1c1
Sequence:CCGGGCCCAACATCATTGACCACTTCTCGAGAAGTGGTCAATGATGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063315.2-294s1c1
Sequence:CCGGCCTCTCCATCTTGGGATCTTACTCGAGTAAGATCCCAAGATGGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks