EMAIL THIS PAGE TO A FRIEND

OR13C3

olfactory receptor, family 13, subfamily C, member 3

Synonyms: OR37G OR9-8
UniProtKB ID: Q8NGS6, Q5VVG1, Q6IF52
Gene ID:
Human(138803) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(481640) cOR13C16 olfactory receptor family 13 subfamily C-like
cow(789792) olfactory receptor, family 13, subfamily C, member 3
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001961 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180842 predicted 656
2 SASI_Hs01_00180843 predicted 654
3 SASI_Hs01_00180844 predicted 657
4 SASI_Hs01_00180845 predicted 505
5 SASI_Hs01_00180846 predicted 407
6 SASI_Hs01_00180848 predicted 607
7 SASI_Hs01_00180847 predicted 702
8 SASI_Hs01_00180849 predicted 103
9 SASI_Hs01_00180850 predicted 82
10 SASI_Hs01_00180851 predicted 147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001961
OR13C3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 13, subfamily C, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-233s1c1
Sequence:CCGGCCAGCATCTTTGATTCTCATTCTCGAGAATGAGAATCAAAGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-658s1c1
Sequence:CCGGGCTGATATATCCCTCAATATTCTCGAGAATATTGAGGGATATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-105s1c1
Sequence:CCGGCCAGACACTTGTGTCAGAATTCTCGAGAATTCTGACACAAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-82s1c1
Sequence:CCGGGCAGATGACATGGGTGAGATTCTCGAGAATCTCACCCATGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-874s1c1
Sequence:CCGGCCGAAGTCTCAAGACCTGATTCTCGAGAATCAGGTCTTGAGACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001961
OR13C3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 13, subfamily C, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-233s1c1
Sequence:CCGGCCAGCATCTTTGATTCTCATTCTCGAGAATGAGAATCAAAGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-658s1c1
Sequence:CCGGGCTGATATATCCCTCAATATTCTCGAGAATATTGAGGGATATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-105s1c1
Sequence:CCGGCCAGACACTTGTGTCAGAATTCTCGAGAATTCTGACACAAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-82s1c1
Sequence:CCGGGCAGATGACATGGGTGAGATTCTCGAGAATCTCACCCATGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-874s1c1
Sequence:CCGGCCGAAGTCTCAAGACCTGATTCTCGAGAATCAGGTCTTGAGACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001961
OR13C3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 13, subfamily C, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-233s1c1
Sequence:CCGGCCAGCATCTTTGATTCTCATTCTCGAGAATGAGAATCAAAGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-658s1c1
Sequence:CCGGGCTGATATATCCCTCAATATTCTCGAGAATATTGAGGGATATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-105s1c1
Sequence:CCGGCCAGACACTTGTGTCAGAATTCTCGAGAATTCTGACACAAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-82s1c1
Sequence:CCGGGCAGATGACATGGGTGAGATTCTCGAGAATCTCACCCATGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001961.1-874s1c1
Sequence:CCGGCCGAAGTCTCAAGACCTGATTCTCGAGAATCAGGTCTTGAGACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks