EMAIL THIS PAGE TO A FRIEND

OR13C9

olfactory receptor, family 13, subfamily C, member 9

Synonyms: OR37L OR9-13
Species: Human OR13C9(286362)
UniProtKB ID: Q8NGT0, Q6IFL2
Gene ID:
Human(286362) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31898 Anti-OR13C9 antibody produced in rabbit affinity isolated antibody pig, rat, horse, canine, human, bovine
western blot pricing
SAB2106239 Anti-OR13C9 antibody produced in rabbit affinity isolated antibody human, horse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_210752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_210752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_210752 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017961 MISSION® esiRNA esiRNA targeting human OR13C9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001956 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140547 predicted 595
2 SASI_Hs01_00140548 predicted 476
3 SASI_Hs01_00140549 predicted 446
4 SASI_Hs01_00140550 predicted 632
5 SASI_Hs01_00140551 predicted 511
6 SASI_Hs01_00140552 predicted 576
7 SASI_Hs01_00140553 predicted 615
8 SASI_Hs01_00140555 predicted 637
9 SASI_Hs01_00140556 predicted 418
10 SASI_Hs02_00304025 predicted 499
11 SASI_Hs01_00140554 predicted 635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_210752
OR13C9 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 13, subfamily C, member 9
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000186335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210752.3-156s1c1
Sequence:CCGGCCTTTCAGAAAGAAAGACCATCTCGAGATGGTCTTTCTTTCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210752.3-157s1c1
Sequence:CCGGCTTTCAGAAAGAAAGACCATTCTCGAGAATGGTCTTTCTTTCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210752.3-687s1c1
Sequence:CCGGCAAGTCTAAAGAGACACTTAACTCGAGTTAAGTGTCTCTTTAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_210752
OR13C9 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 13, subfamily C, member 9
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000186335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210752.3-156s1c1
Sequence:CCGGCCTTTCAGAAAGAAAGACCATCTCGAGATGGTCTTTCTTTCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210752.3-157s1c1
Sequence:CCGGCTTTCAGAAAGAAAGACCATTCTCGAGAATGGTCTTTCTTTCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210752.3-687s1c1
Sequence:CCGGCAAGTCTAAAGAGACACTTAACTCGAGTTAAGTGTCTCTTTAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_210752
OR13C9 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 13, subfamily C, member 9
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000186335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210752.3-156s1c1
Sequence:CCGGCCTTTCAGAAAGAAAGACCATCTCGAGATGGTCTTTCTTTCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210752.3-157s1c1
Sequence:CCGGCTTTCAGAAAGAAAGACCATTCTCGAGAATGGTCTTTCTTTCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210752.3-687s1c1
Sequence:CCGGCAAGTCTAAAGAGACACTTAACTCGAGTTAAGTGTCTCTTTAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks