EMAIL THIS PAGE TO A FRIEND

OR1D5

olfactory receptor, family 1, subfamily D, member 5

Synonyms: C17orf2 OR17-2 OR17-30 OR17-31
UniProtKB ID: P58170, Q96RA6
Gene ID:
Human(8386) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(540255) olfactory receptor, family 1, subfamily D, member 5
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014566 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014566 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048780 predicted 495
2 SASI_Hs01_00048781 predicted 639
3 SASI_Hs02_00345828 predicted 645
4 SASI_Hs02_00345829 predicted 627
5 SASI_Hs01_00048782 predicted 490
6 SASI_Hs01_00048783 predicted 563
7 SASI_Hs01_00048784 predicted 637
8 SASI_Hs01_00048785 predicted 582
9 SASI_Hs01_00048786 predicted 237
10 SASI_Hs01_00048787 predicted 563
11 SASI_Hs01_00048788 predicted 659
12 SASI_Hs01_00048789 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014566
OR1D5 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily D, member 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-579s1c1
Sequence:CCGGCATCATTCACACAGCGTTGATCTCGAGATCAACGCTGTGTGAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-87s1c1
Sequence:CCGGGATGTTCCTGTCCATGTACCTCTCGAGAGGTACATGGACAGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-213s1c1
Sequence:CCGGCTTCTTTGTCACCAACACAATCTCGAGATTGTGTTGGTGACAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-174s1c1
Sequence:CCGGCATGTACTTCTTCCTGGCCAACTCGAGTTGGCCAGGAAGAAGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-249s1c1
Sequence:CCGGGAACTTCCAGTCCCAGAACAACTCGAGTTGTTCTGGGACTGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-522s1c1
Sequence:CCGGCCACTACCTCTTCTGTGACATCTCGAGATGTCACAGAAGAGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014566
OR1D5 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily D, member 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-579s1c1
Sequence:CCGGCATCATTCACACAGCGTTGATCTCGAGATCAACGCTGTGTGAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-87s1c1
Sequence:CCGGGATGTTCCTGTCCATGTACCTCTCGAGAGGTACATGGACAGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-213s1c1
Sequence:CCGGCTTCTTTGTCACCAACACAATCTCGAGATTGTGTTGGTGACAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-174s1c1
Sequence:CCGGCATGTACTTCTTCCTGGCCAACTCGAGTTGGCCAGGAAGAAGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-249s1c1
Sequence:CCGGGAACTTCCAGTCCCAGAACAACTCGAGTTGTTCTGGGACTGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-522s1c1
Sequence:CCGGCCACTACCTCTTCTGTGACATCTCGAGATGTCACAGAAGAGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014566
OR1D5 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily D, member 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-579s1c1
Sequence:CCGGCATCATTCACACAGCGTTGATCTCGAGATCAACGCTGTGTGAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-87s1c1
Sequence:CCGGGATGTTCCTGTCCATGTACCTCTCGAGAGGTACATGGACAGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-213s1c1
Sequence:CCGGCTTCTTTGTCACCAACACAATCTCGAGATTGTGTTGGTGACAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-174s1c1
Sequence:CCGGCATGTACTTCTTCCTGGCCAACTCGAGTTGGCCAGGAAGAAGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-249s1c1
Sequence:CCGGGAACTTCCAGTCCCAGAACAACTCGAGTTGTTCTGGGACTGGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014566.1-522s1c1
Sequence:CCGGCCACTACCTCTTCTGTGACATCTCGAGATGTCACAGAAGAGGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks