EMAIL THIS PAGE TO A FRIEND

OR1J2

olfactory receptor, family 1, subfamily J, member 2

Synonyms: HG152 HSA5 OR1J3 OR1J5 OR9-19 OST044
UniProtKB ID: Q8NGS2, A3KFL9, Q6IF14, Q96R90, Q9NZP1
Gene ID:
Human(26740) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(510571) olfactory receptor, family 1, subfamily J, member 2
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054107 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037251 MISSION® esiRNA esiRNA human OR1J2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054107 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100651 predicted 625
2 SASI_Hs01_00100652 predicted 522
3 SASI_Hs01_00100653 predicted 642
4 SASI_Hs01_00100654 predicted 559
5 SASI_Hs01_00100655 predicted 586
6 SASI_Hs01_00100656 predicted 611
7 SASI_Hs01_00100657 predicted 635
8 SASI_Hs01_00100658 predicted 562
9 SASI_Hs01_00100659 predicted 663
10 SASI_Hs01_00100660 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054107
OR1J2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily J, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-642s1c1
Sequence:CCGGCCTGGTATCATATGGCTACATCTCGAGATGTAGCCATATGATACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-744s1c1
Sequence:CCGGGTCTCTCTATTATGGGTCAATCTCGAGATTGACCCATAATAGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-286s1c1
Sequence:CCGGGAATGCATTTCTCAGATGTATCTCGAGATACATCTGAGAAATGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-255s1c1
Sequence:CCGGGCGGACTAAGTACAAATCGATCTCGAGATCGATTTGTACTTAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-784s1c1
Sequence:CCGGCCGACTGTAAGCAGTTCTATTCTCGAGAATAGAACTGCTTACAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054107
OR1J2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily J, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-642s1c1
Sequence:CCGGCCTGGTATCATATGGCTACATCTCGAGATGTAGCCATATGATACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-744s1c1
Sequence:CCGGGTCTCTCTATTATGGGTCAATCTCGAGATTGACCCATAATAGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-286s1c1
Sequence:CCGGGAATGCATTTCTCAGATGTATCTCGAGATACATCTGAGAAATGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-255s1c1
Sequence:CCGGGCGGACTAAGTACAAATCGATCTCGAGATCGATTTGTACTTAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-784s1c1
Sequence:CCGGCCGACTGTAAGCAGTTCTATTCTCGAGAATAGAACTGCTTACAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054107
OR1J2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily J, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-642s1c1
Sequence:CCGGCCTGGTATCATATGGCTACATCTCGAGATGTAGCCATATGATACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-744s1c1
Sequence:CCGGGTCTCTCTATTATGGGTCAATCTCGAGATTGACCCATAATAGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-286s1c1
Sequence:CCGGGAATGCATTTCTCAGATGTATCTCGAGATACATCTGAGAAATGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-255s1c1
Sequence:CCGGGCGGACTAAGTACAAATCGATCTCGAGATCGATTTGTACTTAGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054107.1-784s1c1
Sequence:CCGGCCGACTGTAAGCAGTTCTATTCTCGAGAATAGAACTGCTTACAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks