EMAIL THIS PAGE TO A FRIEND

OR2A12

olfactory receptor, family 2, subfamily A, member 12

Synonyms: OR2A12P OR2A16P
UniProtKB ID: Q8NGT7, Q6IF43
Gene ID:
Human(346525) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(505454) olfactory receptor, family 2, subfamily A, member 12
dog(100684453) olfactory receptor, family 2, subfamily A, member 12
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305926 ANTI-OR2A12 (C-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_294316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_294316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_294316 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004135 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221562 predicted 528
2 SASI_Hs01_00221563 predicted 219
3 SASI_Hs01_00221564 predicted 455
4 SASI_Hs01_00221565 predicted 301
5 SASI_Hs01_00221566 predicted 585
6 SASI_Hs01_00221567 predicted 526
7 SASI_Hs01_00221568 predicted 585
8 SASI_Hs01_00221569 predicted 426
9 SASI_Hs01_00221570 predicted 276
10 SASI_Hs01_00221571 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_294316
OR2A12 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily A, member 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-531s1c1
Sequence:CCGGCTGTCAAATCATGTCCGTATTCTCGAGAATACGGACATGATTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-781s1c2
Sequence:CCGGCCCAAGTCAAGCCATTCTCAACTCGAGTTGAGAATGGCTTGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-61s1c1
Sequence:CCGGGCTCTGGAGTTGTTCCTCTTTCTCGAGAAAGAGGAACAACTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-430s1c2
Sequence:CCGGGCCTCAACTTGCTGGATATTTCTCGAGAAATATCCAGCAAGTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-319s1c1
Sequence:CCGGGCTATTACAGAGTGTCTGATTCTCGAGAATCAGACACTCTGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_294316
OR2A12 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily A, member 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-531s1c1
Sequence:CCGGCTGTCAAATCATGTCCGTATTCTCGAGAATACGGACATGATTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-781s1c2
Sequence:CCGGCCCAAGTCAAGCCATTCTCAACTCGAGTTGAGAATGGCTTGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-61s1c1
Sequence:CCGGGCTCTGGAGTTGTTCCTCTTTCTCGAGAAAGAGGAACAACTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-430s1c2
Sequence:CCGGGCCTCAACTTGCTGGATATTTCTCGAGAAATATCCAGCAAGTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-319s1c1
Sequence:CCGGGCTATTACAGAGTGTCTGATTCTCGAGAATCAGACACTCTGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_294316
OR2A12 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily A, member 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-531s1c1
Sequence:CCGGCTGTCAAATCATGTCCGTATTCTCGAGAATACGGACATGATTTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-781s1c2
Sequence:CCGGCCCAAGTCAAGCCATTCTCAACTCGAGTTGAGAATGGCTTGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-61s1c1
Sequence:CCGGGCTCTGGAGTTGTTCCTCTTTCTCGAGAAAGAGGAACAACTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-430s1c2
Sequence:CCGGGCCTCAACTTGCTGGATATTTCTCGAGAAATATCCAGCAAGTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_294316.3-319s1c1
Sequence:CCGGGCTATTACAGAGTGTCTGATTCTCGAGAATCAGACACTCTGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks