EMAIL THIS PAGE TO A FRIEND

OR2B11

olfactory receptor, family 2, subfamily B, member 11

UniProtKB ID: Q5JQS5, B2RP03
Gene ID:
Human(127623) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(512138) olfactory receptor, family 2, subfamily B, member 11
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_060580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_060580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_060580 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004492 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004492 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134869 predicted 571
2 SASI_Hs01_00134870 predicted 651
3 SASI_Hs01_00134872 predicted 647
4 SASI_Hs01_00134873 predicted 405
5 SASI_Hs01_00134875 predicted 718
6 SASI_Hs01_00134876 predicted 569
7 SASI_Hs01_00134877 predicted 465
8 SASI_Hs01_00134878 predicted 692
9 SASI_Hs02_00304637 predicted 283
10 SASI_Hs02_00304638 predicted 588
11 SASI_Hs01_00134871 predicted 280
12 SASI_Hs01_00134874 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_060580
OR2B11 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily B, member 11
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000197314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060580.4-913s1c2
Sequence:CCGGGCTCTCATCCTTCTCTCCTATCTCGAGATAGGAGAGAAGGATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060580.4-40s1c1
Sequence:CCGGGTCAAGTTAAATCTGAGGGATCTCGAGATCCCTCAGATTTAACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060580.4-918s1c1
Sequence:CCGGCATCCTTCTCTCCTATGGCTTCTCGAGAAGCCATAGGAGAGAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_060580
OR2B11 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily B, member 11
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000197314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060580.4-913s1c2
Sequence:CCGGGCTCTCATCCTTCTCTCCTATCTCGAGATAGGAGAGAAGGATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060580.4-40s1c1
Sequence:CCGGGTCAAGTTAAATCTGAGGGATCTCGAGATCCCTCAGATTTAACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060580.4-918s1c1
Sequence:CCGGCATCCTTCTCTCCTATGGCTTCTCGAGAAGCCATAGGAGAGAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_060580
OR2B11 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily B, member 11
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000197314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060580.4-913s1c2
Sequence:CCGGGCTCTCATCCTTCTCTCCTATCTCGAGATAGGAGAGAAGGATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060580.4-40s1c1
Sequence:CCGGGTCAAGTTAAATCTGAGGGATCTCGAGATCCCTCAGATTTAACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060580.4-918s1c1
Sequence:CCGGCATCCTTCTCTCCTATGGCTTCTCGAGAAGCCATAGGAGAGAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004492
OR2B11 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily B, member 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-399s21c1
Sequence:CCGGCCTGCACTATGCCGTTCTCATCTCGAGATGAGAACGGCATAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-496s21c1
Sequence:CCGGCTGACGGTGCAATTGCCATTCCTCGAGGAATGGCAATTGCACCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-733s21c1
Sequence:CCGGTGTTCCTCCCACCTGATGATCCTCGAGGATCATCAGGTGGGAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-653s21c1
Sequence:CCGGTCCTTCTCTCCTATGGCTTTACTCGAGTAAAGCCATAGGAGAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-587s21c1
Sequence:CCGGCCGCTGTGAATGACACCATACCTCGAGGTATGGTGTCATTCACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-762s21c1
Sequence:CCGGCTTCTACCTACCTGCGATTTACTCGAGTAAATCGCAGGTAGGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-523s21c1
Sequence:CCGGCGGCAGGTGCTGAACAACTTTCTCGAGAAAGTTGTTCAGCACCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-294s21c1
Sequence:CCGGTGGAGGCTGCACTGTGCAATACTCGAGTATTGCACAGTGCAGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004492
OR2B11 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily B, member 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-399s21c1
Sequence:CCGGCCTGCACTATGCCGTTCTCATCTCGAGATGAGAACGGCATAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-496s21c1
Sequence:CCGGCTGACGGTGCAATTGCCATTCCTCGAGGAATGGCAATTGCACCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-733s21c1
Sequence:CCGGTGTTCCTCCCACCTGATGATCCTCGAGGATCATCAGGTGGGAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-653s21c1
Sequence:CCGGTCCTTCTCTCCTATGGCTTTACTCGAGTAAAGCCATAGGAGAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-587s21c1
Sequence:CCGGCCGCTGTGAATGACACCATACCTCGAGGTATGGTGTCATTCACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-762s21c1
Sequence:CCGGCTTCTACCTACCTGCGATTTACTCGAGTAAATCGCAGGTAGGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-523s21c1
Sequence:CCGGCGGCAGGTGCTGAACAACTTTCTCGAGAAAGTTGTTCAGCACCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-294s21c1
Sequence:CCGGTGGAGGCTGCACTGTGCAATACTCGAGTATTGCACAGTGCAGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004492
OR2B11 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily B, member 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-399s21c1
Sequence:CCGGCCTGCACTATGCCGTTCTCATCTCGAGATGAGAACGGCATAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-496s21c1
Sequence:CCGGCTGACGGTGCAATTGCCATTCCTCGAGGAATGGCAATTGCACCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-733s21c1
Sequence:CCGGTGTTCCTCCCACCTGATGATCCTCGAGGATCATCAGGTGGGAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-653s21c1
Sequence:CCGGTCCTTCTCTCCTATGGCTTTACTCGAGTAAAGCCATAGGAGAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-587s21c1
Sequence:CCGGCCGCTGTGAATGACACCATACCTCGAGGTATGGTGTCATTCACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-762s21c1
Sequence:CCGGCTTCTACCTACCTGCGATTTACTCGAGTAAATCGCAGGTAGGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-523s21c1
Sequence:CCGGCGGCAGGTGCTGAACAACTTTCTCGAGAAAGTTGTTCAGCACCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004492.1-294s21c1
Sequence:CCGGTGGAGGCTGCACTGTGCAATACTCGAGTATTGCACAGTGCAGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks