EMAIL THIS PAGE TO A FRIEND

OR2C3

olfactory receptor, family 2, subfamily C, member 3

Synonyms: OR2C4 OR2C5P OST742
UniProtKB ID: Q8N628, Q5JQS4, Q6IEZ1, Q8NGW7
Gene ID:
Human(81472) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(490580) olfactory receptor, family 2, subfamily C, member 3
cow(522954) olfactory receptor, family 2, subfamily C, member 3
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198074 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042401 MISSION® esiRNA esiRNA human OR2C3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198074 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186907 predicted 1061
2 SASI_Hs01_00186908 predicted 870
3 SASI_Hs01_00186909 predicted 1298
4 SASI_Hs01_00186912 predicted 1049
5 SASI_Hs01_00186913 predicted 955
6 SASI_Hs01_00186914 predicted 628
7 SASI_Hs01_00186915 predicted 1020
8 SASI_Hs01_00186916 predicted 651
9 SASI_Hs02_00371622 predicted 929
10 SASI_Hs02_00371623 predicted 1219
11 SASI_Hs01_00186910 predicted 1376
12 SASI_Hs01_00186911 predicted 966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198074
OR2C3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily C, member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-1266s1c1
Sequence:CCGGCCGGCACATGGTATTAGAGAACTCGAGTTCTCTAATACCATGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-908s1c1
Sequence:CCGGCCCTCATTATGCAACTGGCTTCTCGAGAAGCCAGTTGCATAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-430s1c1
Sequence:CCGGCTAGAAACTGTCCTCTTCATACTCGAGTATGAAGAGGACAGTTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-1210s1c1
Sequence:CCGGCCTGCGCTGAACCCACTTATTCTCGAGAATAAGTGGGTTCAGCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-658s1c1
Sequence:CCGGGTCCAGTTCTATATCTCCCATCTCGAGATGGGAGATATAGAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198074.4-1214s21c1
Sequence:CCGGTGCGCTGAACCCACTTATTTACTCGAGTAAATAAGTGGGTTCAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198074.4-1304s21c1
Sequence:CCGGAGGCAAGCTGGCGCAAATTTACTCGAGTAAATTTGCGCCAGCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198074.4-862s21c1
Sequence:CCGGTACCGCTGTGTGGGAACAATTCTCGAGAATTGTTCCCACACAGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198074.4-1636s21c1
Sequence:CCGGGGACGCTCCGTGGATAATAAACTCGAGTTTATTATCCACGGAGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198074
OR2C3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily C, member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-1266s1c1
Sequence:CCGGCCGGCACATGGTATTAGAGAACTCGAGTTCTCTAATACCATGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-908s1c1
Sequence:CCGGCCCTCATTATGCAACTGGCTTCTCGAGAAGCCAGTTGCATAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-430s1c1
Sequence:CCGGCTAGAAACTGTCCTCTTCATACTCGAGTATGAAGAGGACAGTTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-1210s1c1
Sequence:CCGGCCTGCGCTGAACCCACTTATTCTCGAGAATAAGTGGGTTCAGCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-658s1c1
Sequence:CCGGGTCCAGTTCTATATCTCCCATCTCGAGATGGGAGATATAGAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198074.4-1214s21c1
Sequence:CCGGTGCGCTGAACCCACTTATTTACTCGAGTAAATAAGTGGGTTCAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198074.4-1304s21c1
Sequence:CCGGAGGCAAGCTGGCGCAAATTTACTCGAGTAAATTTGCGCCAGCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198074.4-862s21c1
Sequence:CCGGTACCGCTGTGTGGGAACAATTCTCGAGAATTGTTCCCACACAGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198074.4-1636s21c1
Sequence:CCGGGGACGCTCCGTGGATAATAAACTCGAGTTTATTATCCACGGAGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198074
OR2C3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily C, member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-1266s1c1
Sequence:CCGGCCGGCACATGGTATTAGAGAACTCGAGTTCTCTAATACCATGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-908s1c1
Sequence:CCGGCCCTCATTATGCAACTGGCTTCTCGAGAAGCCAGTTGCATAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-430s1c1
Sequence:CCGGCTAGAAACTGTCCTCTTCATACTCGAGTATGAAGAGGACAGTTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-1210s1c1
Sequence:CCGGCCTGCGCTGAACCCACTTATTCTCGAGAATAAGTGGGTTCAGCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198074.3-658s1c1
Sequence:CCGGGTCCAGTTCTATATCTCCCATCTCGAGATGGGAGATATAGAACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198074.4-1214s21c1
Sequence:CCGGTGCGCTGAACCCACTTATTTACTCGAGTAAATAAGTGGGTTCAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198074.4-1304s21c1
Sequence:CCGGAGGCAAGCTGGCGCAAATTTACTCGAGTAAATTTGCGCCAGCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198074.4-862s21c1
Sequence:CCGGTACCGCTGTGTGGGAACAATTCTCGAGAATTGTTCCCACACAGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198074.4-1636s21c1
Sequence:CCGGGGACGCTCCGTGGATAATAAACTCGAGTTTATTATCCACGGAGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks