EMAIL THIS PAGE TO A FRIEND

OR2D2

olfactory receptor, family 2, subfamily D, member 2

Synonyms: OR11-610 OR2D1 hg27
UniProtKB ID: Q9H210, B9EIL5, O95224, Q6IF28, Q8NGH4, Q96R52
Gene ID:
Human(120776) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(504498) olfactory receptor, family 2, subfamily D, member 2
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500300 Anti-OR2D2, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003700 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003700 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199884 predicted 563
2 SASI_Hs01_00199885 predicted 450
3 SASI_Hs01_00199886 predicted 260
4 SASI_Hs01_00199887 predicted 570
5 SASI_Hs01_00199888 predicted 540
6 SASI_Hs01_00199889 predicted 647
7 SASI_Hs01_00199890 predicted 427
8 SASI_Hs01_00199891 predicted 223
9 SASI_Hs01_00199892 predicted 459
10 SASI_Hs02_00336117 predicted 278
11 SASI_Hs01_00199893 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003700
OR2D2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily D, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003700.1-757s21c1
Sequence:CCGGGGATCAGCAATTATCACTTACCTCGAGGTAAGTGATAATTGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003700.1-74s21c1
Sequence:CCGGAGCTGCTATTTATCGTATTATCTCGAGATAATACGATAAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003700.1-257s21c1
Sequence:CCGGTTTCCAGAAAGAAGGTCATTGCTCGAGCAATGACCTTCTTTCTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-117s1c1
Sequence:CCGGGCTTGGAAATCTGCTTCTAATCTCGAGATTAGAAGCAGATTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-545s1c1
Sequence:CCGGCTGCACTATTGATCTTAGCATCTCGAGATGCTAAGATCAATAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-260s1c1
Sequence:CCGGCCAGAAAGAAGGTCATTGCATCTCGAGATGCAATGACCTTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-773s1c1
Sequence:CCGGCTTACATGACACCCAAGTCTTCTCGAGAAGACTTGGGTGTCATGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-72s1c1
Sequence:CCGGGCAGCTGCTATTTATCGTATTCTCGAGAATACGATAAATAGCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003700
OR2D2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily D, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003700.1-757s21c1
Sequence:CCGGGGATCAGCAATTATCACTTACCTCGAGGTAAGTGATAATTGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003700.1-74s21c1
Sequence:CCGGAGCTGCTATTTATCGTATTATCTCGAGATAATACGATAAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003700.1-257s21c1
Sequence:CCGGTTTCCAGAAAGAAGGTCATTGCTCGAGCAATGACCTTCTTTCTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-117s1c1
Sequence:CCGGGCTTGGAAATCTGCTTCTAATCTCGAGATTAGAAGCAGATTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-545s1c1
Sequence:CCGGCTGCACTATTGATCTTAGCATCTCGAGATGCTAAGATCAATAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-260s1c1
Sequence:CCGGCCAGAAAGAAGGTCATTGCATCTCGAGATGCAATGACCTTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-773s1c1
Sequence:CCGGCTTACATGACACCCAAGTCTTCTCGAGAAGACTTGGGTGTCATGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-72s1c1
Sequence:CCGGGCAGCTGCTATTTATCGTATTCTCGAGAATACGATAAATAGCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003700
OR2D2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily D, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003700.1-757s21c1
Sequence:CCGGGGATCAGCAATTATCACTTACCTCGAGGTAAGTGATAATTGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003700.1-74s21c1
Sequence:CCGGAGCTGCTATTTATCGTATTATCTCGAGATAATACGATAAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003700.1-257s21c1
Sequence:CCGGTTTCCAGAAAGAAGGTCATTGCTCGAGCAATGACCTTCTTTCTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-117s1c1
Sequence:CCGGGCTTGGAAATCTGCTTCTAATCTCGAGATTAGAAGCAGATTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-545s1c1
Sequence:CCGGCTGCACTATTGATCTTAGCATCTCGAGATGCTAAGATCAATAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-260s1c1
Sequence:CCGGCCAGAAAGAAGGTCATTGCATCTCGAGATGCAATGACCTTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-773s1c1
Sequence:CCGGCTTACATGACACCCAAGTCTTCTCGAGAAGACTTGGGTGTCATGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003700.1-72s1c1
Sequence:CCGGGCAGCTGCTATTTATCGTATTCTCGAGAATACGATAAATAGCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks