EMAIL THIS PAGE TO A FRIEND

OR2J3

olfactory receptor, family 2, subfamily J, member 3

Synonyms: 6M1-3 C3HEXS HS6M1-3 OR6-16 OR6-6 OR6.3.6 ORL671
Gene ID:
Human(442186) Summary: This gene encodes a G-protein-coupled receptor (GPCR) that functions as an olfactory receptor. Olfactory receptors interact with odorant molecules in the nose to initiate a neuronal response that triggers the perception of a smell. The protein encoded by this gene responds to cis-3-hexen-1-ol, which is released by wounded plants, including cut grass. This gene is situated in a cluster of similar olfactory-receptor coding genes on chromosome 6. [provided by RefSeq, May 2013]
cow(784712) olfactory receptor, family 2, subfamily J, member 3
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005216 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005216 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051398 predicted 706
2 SASI_Hs01_00051399 predicted 714
3 SASI_Hs01_00051400 predicted 707
4 SASI_Hs01_00051401 predicted 702
5 SASI_Hs02_00304787 predicted 671
6 SASI_Hs01_00051402 predicted 873
7 SASI_Hs01_00051403 predicted 67
8 SASI_Hs01_00051404 predicted 555
9 SASI_Hs02_00304788 predicted 676
10 SASI_Hs01_00051405 predicted 559
11 SASI_Hs01_00051406 predicted 364
12 SASI_Hs01_00051407 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005216
OR2J3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily J, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-702s1c1
Sequence:CCGGCACTGGGCTTCAGAAAGTGTTCTCGAGAACACTTTCTGAAGCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-292s1c1
Sequence:CCGGGCTGGTTGCATGATTCAACTTCTCGAGAAGTTGAATCATGCAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-572s1c1
Sequence:CCGGCGTGTGTTGATACCCATGTCACTCGAGTGACATGGGTATCAACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-174s1c1
Sequence:CCGGGCACACACCAATGTACTTCTTCTCGAGAAGAAGTACATTGGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-192s1c1
Sequence:CCGGCTTCCTTTCAAACCTCTCATTCTCGAGAATGAGAGGTTTGAAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-73s1c1
Sequence:CCGGCATCTGGAAGTAGTTATCTTTCTCGAGAAAGATAACTACTTCCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005216
OR2J3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily J, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-702s1c1
Sequence:CCGGCACTGGGCTTCAGAAAGTGTTCTCGAGAACACTTTCTGAAGCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-292s1c1
Sequence:CCGGGCTGGTTGCATGATTCAACTTCTCGAGAAGTTGAATCATGCAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-572s1c1
Sequence:CCGGCGTGTGTTGATACCCATGTCACTCGAGTGACATGGGTATCAACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-174s1c1
Sequence:CCGGGCACACACCAATGTACTTCTTCTCGAGAAGAAGTACATTGGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-192s1c1
Sequence:CCGGCTTCCTTTCAAACCTCTCATTCTCGAGAATGAGAGGTTTGAAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-73s1c1
Sequence:CCGGCATCTGGAAGTAGTTATCTTTCTCGAGAAAGATAACTACTTCCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005216
OR2J3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily J, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-702s1c1
Sequence:CCGGCACTGGGCTTCAGAAAGTGTTCTCGAGAACACTTTCTGAAGCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-292s1c1
Sequence:CCGGGCTGGTTGCATGATTCAACTTCTCGAGAAGTTGAATCATGCAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-572s1c1
Sequence:CCGGCGTGTGTTGATACCCATGTCACTCGAGTGACATGGGTATCAACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-174s1c1
Sequence:CCGGGCACACACCAATGTACTTCTTCTCGAGAAGAAGTACATTGGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-192s1c1
Sequence:CCGGCTTCCTTTCAAACCTCTCATTCTCGAGAATGAGAGGTTTGAAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005216.1-73s1c1
Sequence:CCGGCATCTGGAAGTAGTTATCTTTCTCGAGAAAGATAACTACTTCCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks