EMAIL THIS PAGE TO A FRIEND

OR2T27

olfactory receptor, family 2, subfamily T, member 27

UniProtKB ID: Q8NH04
Gene ID:
Human(403239) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(515313) olfactory receptor, family 2, subfamily T, member 27
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301861 ANTI-OR2T27 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001824 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193258 predicted 292
2 SASI_Hs01_00193260 predicted 209
3 SASI_Hs01_00193261 predicted 633
4 SASI_Hs01_00193262 predicted 396
5 SASI_Hs01_00193263 predicted 298
6 SASI_Hs01_00193264 predicted 392
7 SASI_Hs01_00193265 predicted 659
8 SASI_Hs01_00193266 predicted 570
9 SASI_Hs01_00193267 predicted 644
10 SASI_Hs02_00303954 predicted 410
11 SASI_Hs01_00193259 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001824
OR2T27 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily T, member 27
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-126s1c1
Sequence:CCGGCGTGGTCAAGATCATTCTCATCTCGAGATGAGAATGATCTTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-29s1c1
Sequence:CCGGCCGACTTTATCCTTCTGGGTTCTCGAGAACCCAGAAGGATAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-621s1c1
Sequence:CCGGCCTCATCCCTTTCTCTGTCATCTCGAGATGACAGAGAAAGGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-642s1c1
Sequence:CCGGCTCGGGCTCTTACACAAGAATCTCGAGATTCTTGTGTAAGAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-201s1c1
Sequence:CCGGCCTCAGGGACATCCTGTATATCTCGAGATATACAGGATGTCCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001824
OR2T27 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily T, member 27
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-126s1c1
Sequence:CCGGCGTGGTCAAGATCATTCTCATCTCGAGATGAGAATGATCTTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-29s1c1
Sequence:CCGGCCGACTTTATCCTTCTGGGTTCTCGAGAACCCAGAAGGATAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-621s1c1
Sequence:CCGGCCTCATCCCTTTCTCTGTCATCTCGAGATGACAGAGAAAGGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-642s1c1
Sequence:CCGGCTCGGGCTCTTACACAAGAATCTCGAGATTCTTGTGTAAGAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-201s1c1
Sequence:CCGGCCTCAGGGACATCCTGTATATCTCGAGATATACAGGATGTCCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001824
OR2T27 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily T, member 27
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-126s1c1
Sequence:CCGGCGTGGTCAAGATCATTCTCATCTCGAGATGAGAATGATCTTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-29s1c1
Sequence:CCGGCCGACTTTATCCTTCTGGGTTCTCGAGAACCCAGAAGGATAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-621s1c1
Sequence:CCGGCCTCATCCCTTTCTCTGTCATCTCGAGATGACAGAGAAAGGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-642s1c1
Sequence:CCGGCTCGGGCTCTTACACAAGAATCTCGAGATTCTTGTGTAAGAGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001824.1-201s1c1
Sequence:CCGGCCTCAGGGACATCCTGTATATCTCGAGATATACAGGATGTCCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks