EMAIL THIS PAGE TO A FRIEND

OR4A47

olfactory receptor, family 4, subfamily A, member 47

Synonyms: OR11-113
Species: Human OR4A47(403253)
UniProtKB ID: Q6IF82
Gene ID:
Human(403253) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005512 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005512 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304976 predicted 408
2 SASI_Hs01_00232915 predicted 252
3 SASI_Hs01_00232916 predicted 439
4 SASI_Hs01_00232918 predicted 610
5 SASI_Hs01_00232919 predicted 400
6 SASI_Hs02_00304977 predicted 601
7 SASI_Hs01_00232920 predicted 436
8 SASI_Hs01_00232921 predicted 612
9 SASI_Hs01_00232922 predicted 521
10 SASI_Hs01_00232923 predicted 233
11 SASI_Hs01_00232917 predicted 567
12 SASI_Hs01_00232924 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005512
OR4A47 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily A, member 47
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000204265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005512.1-292s1c1
Sequence:CCGGCAGCTCTTTATCGAGCACCTTCTCGAGAAGGTGCTCGATAAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005512.1-181s1c1
Sequence:CCGGCTTGCTGGCTTATCATTTATACTCGAGTATAAATGATAAGCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005512
OR4A47 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily A, member 47
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000204265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005512.1-292s1c1
Sequence:CCGGCAGCTCTTTATCGAGCACCTTCTCGAGAAGGTGCTCGATAAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005512.1-181s1c1
Sequence:CCGGCTTGCTGGCTTATCATTTATACTCGAGTATAAATGATAAGCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005512
OR4A47 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily A, member 47
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000204265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005512.1-292s1c1
Sequence:CCGGCAGCTCTTTATCGAGCACCTTCTCGAGAAGGTGCTCGATAAAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005512.1-181s1c1
Sequence:CCGGCTTGCTGGCTTATCATTTATACTCGAGTATAAATGATAAGCCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks