EMAIL THIS PAGE TO A FRIEND

OR4C45

olfactory receptor, family 4, subfamily C, member 45

Species: Human OR4C45(403257)
UniProtKB ID: A6NMZ5
Gene ID:
Human(403257) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005513 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154331 predicted 695
2 SASI_Hs01_00154332 predicted 226
3 SASI_Hs01_00154333 predicted 664
4 SASI_Hs01_00154334 predicted 311
5 SASI_Hs01_00154335 predicted 566
6 SASI_Hs01_00154336 predicted 383
7 SASI_Hs01_00154337 predicted 649
8 SASI_Hs01_00154338 predicted 680
9 SASI_Hs01_00154339 predicted 550
10 SASI_Hs01_00154340 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005513
OR4C45 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily C, member 45
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-382s1c1
Sequence:CCGGGCAACCATCATGACCCAATCTCTCGAGAGATTGGGTCATGATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-658s1c1
Sequence:CCGGCTAAGGTCTCATAGCTCTGAACTCGAGTTCAGAGCTATGAGACCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-742s1c1
Sequence:CCGGCCTTGTTCATACCTGTATCTACTCGAGTAGATACAGGTATGAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-508s1c1
Sequence:CCGGGACCACTTTATGTGTGATTTACTCGAGTAAATCACACATAAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-318s1c1
Sequence:CCGGGACCATCTTATTAAGTGTCATCTCGAGATGACACTTAATAAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005513
OR4C45 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily C, member 45
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-382s1c1
Sequence:CCGGGCAACCATCATGACCCAATCTCTCGAGAGATTGGGTCATGATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-658s1c1
Sequence:CCGGCTAAGGTCTCATAGCTCTGAACTCGAGTTCAGAGCTATGAGACCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-742s1c1
Sequence:CCGGCCTTGTTCATACCTGTATCTACTCGAGTAGATACAGGTATGAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-508s1c1
Sequence:CCGGGACCACTTTATGTGTGATTTACTCGAGTAAATCACACATAAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-318s1c1
Sequence:CCGGGACCATCTTATTAAGTGTCATCTCGAGATGACACTTAATAAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005513
OR4C45 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily C, member 45
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-382s1c1
Sequence:CCGGGCAACCATCATGACCCAATCTCTCGAGAGATTGGGTCATGATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-658s1c1
Sequence:CCGGCTAAGGTCTCATAGCTCTGAACTCGAGTTCAGAGCTATGAGACCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-742s1c1
Sequence:CCGGCCTTGTTCATACCTGTATCTACTCGAGTAGATACAGGTATGAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-508s1c1
Sequence:CCGGGACCACTTTATGTGTGATTTACTCGAGTAAATCACACATAAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005513.1-318s1c1
Sequence:CCGGGACCATCTTATTAAGTGTCATCTCGAGATGACACTTAATAAGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks