EMAIL THIS PAGE TO A FRIEND

OR4F4

olfactory receptor, family 4, subfamily F, member 4

Synonyms: OLA-7501 OR4F18
Species: Human OR4F4(26682)
UniProtKB ID: Q96R69, B2RNI5, Q6IFN9
Gene ID:
Human(26682) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303053 ANTI-OR4F4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB4501157 Anti-OR4F4, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004195 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147961 MISSION® esiRNA esiRNA human OR4F4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004195 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107143 predicted 542
2 SASI_Hs01_00107145 predicted 614
3 SASI_Hs01_00107146 predicted 241
4 SASI_Hs01_00107147 predicted 662
5 SASI_Hs01_00107148 predicted 324
6 SASI_Hs01_00107149 predicted 516
7 SASI_Hs01_00107150 predicted 340
8 SASI_Hs01_00107151 predicted 398
9 SASI_Hs02_00304485 predicted 651
10 SASI_Hs02_00304486 predicted 458
11 SASI_Hs01_00107142 predicted 653
12 SASI_Hs01_00107144 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004195
OR4F4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily F, member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-590s1c1
Sequence:CCGGGTGTGCTCACTGTGTGTTCTTCTCGAGAAGAACACACAGTGAGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-375s1c1
Sequence:CCGGCACTACAATTATGTGTGGCAACTCGAGTTGCCACACATAATTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-271s1c1
Sequence:CCGGCTTGTTCAGATATTTCTCCTTCTCGAGAAGGAGAAATATCTGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-109s1c1
Sequence:CCGGCTTATTGTCATAACAGTGGTACTCGAGTACCACTGTTATGACAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004195
OR4F4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily F, member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-590s1c1
Sequence:CCGGGTGTGCTCACTGTGTGTTCTTCTCGAGAAGAACACACAGTGAGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-375s1c1
Sequence:CCGGCACTACAATTATGTGTGGCAACTCGAGTTGCCACACATAATTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-271s1c1
Sequence:CCGGCTTGTTCAGATATTTCTCCTTCTCGAGAAGGAGAAATATCTGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-109s1c1
Sequence:CCGGCTTATTGTCATAACAGTGGTACTCGAGTACCACTGTTATGACAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004195
OR4F4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily F, member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-590s1c1
Sequence:CCGGGTGTGCTCACTGTGTGTTCTTCTCGAGAAGAACACACAGTGAGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-375s1c1
Sequence:CCGGCACTACAATTATGTGTGGCAACTCGAGTTGCCACACATAATTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-271s1c1
Sequence:CCGGCTTGTTCAGATATTTCTCCTTCTCGAGAAGGAGAAATATCTGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004195.1-109s1c1
Sequence:CCGGCTTATTGTCATAACAGTGGTACTCGAGTACCACTGTTATGACAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks