EMAIL THIS PAGE TO A FRIEND

OR4X2

olfactory receptor, family 4, subfamily X, member 2

Synonyms: OR11-105
UniProtKB ID: Q8NGF9, B2RNK3, Q6IF73, Q96R63
Gene ID:
Human(119764) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483613) olfactory receptor, family 4, subfamily X, member 2
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_061666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_061666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_061666 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135881 MISSION® esiRNA esiRNA human OR4X2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004727 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105627 predicted 388
2 SASI_Hs01_00105629 predicted 616
3 SASI_Hs01_00105630 predicted 625
4 SASI_Hs01_00105631 predicted 371
5 SASI_Hs01_00105632 predicted 549
6 SASI_Hs01_00105633 predicted 399
7 SASI_Hs01_00105634 predicted 221
8 SASI_Hs01_00105635 predicted 622
9 SASI_Hs01_00105628 predicted 229
10 SASI_Hs02_00304686 predicted 420
11 SASI_Hs01_00105636 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_061666
OR4X2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily X, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000189006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-45s1c1
Sequence:CCGGGCAGAGGGTTTGCTTTGTGATCTCGAGATCACAAAGCAAACCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-488s1c1
Sequence:CCGGCCAATGTGATCAATCACTATTCTCGAGAATAGTGATTGATCACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-487s1c1
Sequence:CCGGCCCAATGTGATCAATCACTATCTCGAGATAGTGATTGATCACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-699s1c1
Sequence:CCGGGTCCCATTTCGCTGTGGTTATCTCGAGATAACCACAGCGAAATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_061666
OR4X2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily X, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000189006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-45s1c1
Sequence:CCGGGCAGAGGGTTTGCTTTGTGATCTCGAGATCACAAAGCAAACCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-488s1c1
Sequence:CCGGCCAATGTGATCAATCACTATTCTCGAGAATAGTGATTGATCACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-487s1c1
Sequence:CCGGCCCAATGTGATCAATCACTATCTCGAGATAGTGATTGATCACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-699s1c1
Sequence:CCGGGTCCCATTTCGCTGTGGTTATCTCGAGATAACCACAGCGAAATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_061666
OR4X2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily X, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000189006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-45s1c1
Sequence:CCGGGCAGAGGGTTTGCTTTGTGATCTCGAGATCACAAAGCAAACCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-488s1c1
Sequence:CCGGCCAATGTGATCAATCACTATTCTCGAGAATAGTGATTGATCACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-487s1c1
Sequence:CCGGCCCAATGTGATCAATCACTATCTCGAGATAGTGATTGATCACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061666.3-699s1c1
Sequence:CCGGGTCCCATTTCGCTGTGGTTATCTCGAGATAACCACAGCGAAATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks