EMAIL THIS PAGE TO A FRIEND

OR51A2

olfactory receptor, family 51, subfamily A, member 2

Species: Human OR51A2(401667)
UniProtKB ID: Q8NGJ7
Gene ID:
Human(401667) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501774 Anti-OR51A2 antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_377159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377159 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004748 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113417 predicted 670
2 SASI_Hs01_00113418 predicted 646
3 SASI_Hs01_00113419 predicted 210
4 SASI_Hs01_00113420 predicted 397
5 SASI_Hs01_00113421 predicted 425
6 SASI_Hs01_00113422 predicted 614
7 SASI_Hs01_00113423 predicted 697
8 SASI_Hs01_00113424 predicted 205
9 SASI_Hs01_00113425 predicted 521
10 SASI_Hs01_00113426 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377159
OR51A2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily A, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-676s1c1
Sequence:CCGGGTACCGGGAATTGCATCCAAACTCGAGTTTGGATGCAATTCCCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-747s1c1
Sequence:CCGGGATCATCTTCTACCTGCCCATCTCGAGATGGGCAGGTAGAAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-36s1c1
Sequence:CCGGCACCTTCTTCTTGGTTGGGATCTCGAGATCCCAACCAAGAAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-381s1c1
Sequence:CCGGCATCCACAATCCTCTGAGATACTCGAGTATCTCAGAGGATTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-124s1c1
Sequence:CCGGCTAGGAAATGGCACCATTCTTCTCGAGAAGAATGGTGCCATTTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377159
OR51A2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily A, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-676s1c1
Sequence:CCGGGTACCGGGAATTGCATCCAAACTCGAGTTTGGATGCAATTCCCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-747s1c1
Sequence:CCGGGATCATCTTCTACCTGCCCATCTCGAGATGGGCAGGTAGAAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-36s1c1
Sequence:CCGGCACCTTCTTCTTGGTTGGGATCTCGAGATCCCAACCAAGAAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-381s1c1
Sequence:CCGGCATCCACAATCCTCTGAGATACTCGAGTATCTCAGAGGATTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-124s1c1
Sequence:CCGGCTAGGAAATGGCACCATTCTTCTCGAGAAGAATGGTGCCATTTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377159
OR51A2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily A, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-676s1c1
Sequence:CCGGGTACCGGGAATTGCATCCAAACTCGAGTTTGGATGCAATTCCCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-747s1c1
Sequence:CCGGGATCATCTTCTACCTGCCCATCTCGAGATGGGCAGGTAGAAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-36s1c1
Sequence:CCGGCACCTTCTTCTTGGTTGGGATCTCGAGATCCCAACCAAGAAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-381s1c1
Sequence:CCGGCATCCACAATCCTCTGAGATACTCGAGTATCTCAGAGGATTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_377159.1-124s1c1
Sequence:CCGGCTAGGAAATGGCACCATTCTTCTCGAGAAGAATGGTGCCATTTCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks