EMAIL THIS PAGE TO A FRIEND

OR51B6

olfactory receptor, family 51, subfamily B, member 6

Synonyms: HOR5'Beta6
Species: Human OR51B6(390058)
UniProtKB ID: Q9H340
Gene ID:
Human(390058) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004750 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004750 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150825 predicted 281
2 SASI_Hs01_00150826 predicted 204
3 SASI_Hs01_00150827 predicted 471
4 SASI_Hs01_00150828 predicted 461
5 SASI_Hs01_00150829 predicted 399
6 SASI_Hs01_00150831 predicted 341
7 SASI_Hs01_00150832 predicted 574
8 SASI_Hs01_00150833 predicted 506
9 SASI_Hs01_00150834 predicted 413
10 SASI_Hs02_00304700 predicted 324
11 SASI_Hs01_00150830 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004750
OR51B6 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily B, member 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-207s1c1
Sequence:CCGGCGGAGTGACATTGACCACAATCTCGAGATTGTGGTCAATGTCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-523s1c1
Sequence:CCGGGCTTTCTGTCTACACCAAGATCTCGAGATCTTGGTGTAGACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-67s1c1
Sequence:CCGGCACTGGATATTCATCCCATTACTCGAGTAATGGGATGAATATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-674s1c1
Sequence:CCGGGCATTGGTTCTGGAGGAGAAACTCGAGTTTCTCCTCCAGAACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-91s1c1
Sequence:CCGGGCAGCCTACATCTCCATACTTCTCGAGAAGTATGGAGATGTAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004750
OR51B6 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily B, member 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-207s1c1
Sequence:CCGGCGGAGTGACATTGACCACAATCTCGAGATTGTGGTCAATGTCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-523s1c1
Sequence:CCGGGCTTTCTGTCTACACCAAGATCTCGAGATCTTGGTGTAGACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-67s1c1
Sequence:CCGGCACTGGATATTCATCCCATTACTCGAGTAATGGGATGAATATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-674s1c1
Sequence:CCGGGCATTGGTTCTGGAGGAGAAACTCGAGTTTCTCCTCCAGAACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-91s1c1
Sequence:CCGGGCAGCCTACATCTCCATACTTCTCGAGAAGTATGGAGATGTAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004750
OR51B6 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily B, member 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-207s1c1
Sequence:CCGGCGGAGTGACATTGACCACAATCTCGAGATTGTGGTCAATGTCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-523s1c1
Sequence:CCGGGCTTTCTGTCTACACCAAGATCTCGAGATCTTGGTGTAGACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-67s1c1
Sequence:CCGGCACTGGATATTCATCCCATTACTCGAGTAATGGGATGAATATCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-674s1c1
Sequence:CCGGGCATTGGTTCTGGAGGAGAAACTCGAGTTTCTCCTCCAGAACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004750.1-91s1c1
Sequence:CCGGGCAGCCTACATCTCCATACTTCTCGAGAAGTATGGAGATGTAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks